Rmu_ssc0000397.1_g000002

Indigoidine synthase A like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000397.1
Physical Location & Seq
Reverse (-)
19516 .. 25490
5975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000397.1_g000002.1.cds

Sequence Viewer

Length: 735 bp
atgtctgagatggcagagctaaaattctcacttccagcacctctagcattccaaaaaagaattttaaacattaaaaaagtgggaaggagagggtacacaccccagcttagacatcaaccttaccctccccatcatgaggaggggggcagaccaaaaatagctgaaattcctttgtctaagacatcagaacctatgaagcacggatacgccattttggcttcgtatcccgtaccgatccgggatacggctgtcatctctgctggtgtaaaatcaattttggatatcccaaggaccctcgaatatttggaaacacagggagtttgtgtagctgcttacaagaccaatgaatttccagcatttttcacagaagcaagtggctgcaaggtgccttgccgtatagataccccagatgattgcgctcggcttatagatgcaaaccttaaacttgagcttggaactggaatgttgattgctgttccaattcctaaagaacactcggcttctggaaatttaattgagtctgcaatacagactgctctcagagaagctagggataagaacataacaggcaatgctgctactccattcttgcttgcaagagtaaatgaactaactggaggagcatctttggcttcgaacattgccctggtgaagaataatgcacttgttggttctaaaattgctgtagcactttcccggatcagagaatgttgtagaaaaggtggtttggagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

244

Amino Acids

26.38

Weight (kDa)

9.12

Isoelectric Point (pI)

38.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 385
AclWI GGATC 2 cut(s) 229, 707
AcsI RAATTY 5 cut(s) 23, 60, 165, 347, 508
AfaI GTAC 2 cut(s) 95, 231
AfiI CCNNNNNNNGG 2 cut(s) 136, 244
AjnI CCWGG 1 cut(s) 645
AluBI AGCT 6 cut(s) 19, 106, 161, 329, 451, 548
AluI AGCT 6 cut(s) 19, 106, 161, 329, 451, 548
AlwI GGATC 2 cut(s) 229, 707
ApeKI GCWGC 3 cut(s) 329, 378, 575
ApoI RAATTY 5 cut(s) 23, 60, 165, 347, 508
AspLEI GCGC 1 cut(s) 419
AspS9I GGNCC 1 cut(s) 291
AsuC2I CCSGG 2 cut(s) 239, 697
AsuHPI GGTGA 1 cut(s) 661
AsuII TTCGAA 1 cut(s) 635
AvaII GGWCC 1 cut(s) 291
BaeI ACNNNNGTAYC 2 cut(s) 234, 267
BanI GGYRCC 1 cut(s) 385
BarI GAAGNNNNNNTAC 2 cut(s) 188, 220
BbvI GCAGC 3 cut(s) 316, 365, 562
BccI CCATC 2 cut(s) 4, 138
BceAI ACGGC 2 cut(s) 261, 378
BciT130I CCWGG 1 cut(s) 647
BciVI GTATCC 3 cut(s) 197, 234, 235
BcnI CCSGG 2 cut(s) 239, 697
BfaI CTAG 2 cut(s) 44, 549
BfmI CTRYAG 1 cut(s) 684
BfuI GTATCC 3 cut(s) 197, 234, 235
BglI GCCNNNNNGGC 1 cut(s) 215
BisI GCNGC 3 cut(s) 330, 379, 576
BlsI GCNGC 3 cut(s) 331, 380, 577
Bme1390I CCNGG 3 cut(s) 239, 647, 697
Bme18I GGWCC 1 cut(s) 291
BmgT120I GGNCC 1 cut(s) 291
BmiI GGNNCC 2 cut(s) 293, 387
BmrFI CCNGG 3 cut(s) 239, 647, 697
BmsI GCATC 2 cut(s) 421, 632
BpmI CTGGAG 1 cut(s) 636
Bpu14I TTCGAA 1 cut(s) 635
BpuEI CTTGAG 1 cut(s) 467
BpuMI CCSGG 2 cut(s) 239, 697
BsaJI CCNNGG 2 cut(s) 287, 645
BsaXI ACNNNNNCTCC 2 cut(s) 309, 339
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 244
Bse1I ACTGG 2 cut(s) 463, 619
Bse3DI GCAATG 2 cut(s) 577, 639
BseBI CCWGG 1 cut(s) 647
BseDI CCNNGG 2 cut(s) 287, 645
BseLI CCNNNNNNNGG 2 cut(s) 136, 244
BseMI GCAATG 2 cut(s) 577, 639
BseMII CTCAG 1 cut(s) 553
BseNI ACTGG 2 cut(s) 463, 619
BseRI GAGGAG 2 cut(s) 152, 633
BseXI GCAGC 3 cut(s) 316, 365, 562
BseYI CCCAGC 1 cut(s) 102
BshNI GGYRCC 1 cut(s) 385
BsiSI CCGG 2 cut(s) 238, 697
BslI CCNNNNNNNGG 2 cut(s) 136, 244
BsmI GAATGC 1 cut(s) 47
Bsp119I TTCGAA 1 cut(s) 635
Bsp143I GATC 2 cut(s) 234, 699
BspCNI CTCAG 1 cut(s) 552
BspHI TCATGA 1 cut(s) 133
BspLI GGNNCC 2 cut(s) 293, 387
BspPI GGATC 2 cut(s) 229, 707
BspT104I TTCGAA 1 cut(s) 635
BspT107I GGYRCC 1 cut(s) 385
BsrDI GCAATG 2 cut(s) 577, 639
BsrI ACTGG 2 cut(s) 463, 619
BssECI CCNNGG 2 cut(s) 287, 645
BssMI GATC 2 cut(s) 234, 699
BssT1I CCWWGG 1 cut(s) 287
Bst2UI CCWGG 1 cut(s) 647
BstBI TTCGAA 1 cut(s) 635
BstC8I GCNNGC 1 cut(s) 594
BstDEI CTNAG 4 cut(s) 6, 107, 177, 539
BstHHI GCGC 1 cut(s) 419
BstKTI GATC 2 cut(s) 237, 702
BstMBI GATC 2 cut(s) 234, 699
BstMWI GCNNNNNNNGC 3 cut(s) 44, 215, 629
BstNI CCWGG 1 cut(s) 647
BstSCI CCNGG 3 cut(s) 237, 645, 695
BstSFI CTRYAG 1 cut(s) 684
BstV1I GCAGC 3 cut(s) 316, 365, 562
BsuI GTATCC 3 cut(s) 197, 234, 235
Cac8I GCNNGC 1 cut(s) 594
CciI TCATGA 1 cut(s) 133
CfoI GCGC 1 cut(s) 419
Cfr13I GGNCC 1 cut(s) 291
Csp6I GTAC 2 cut(s) 94, 230
CviAII CATG 1 cut(s) 134
CviQI GTAC 2 cut(s) 94, 230
DdeI CTNAG 4 cut(s) 6, 107, 177, 539
DpnI GATC 2 cut(s) 236, 701
DpnII GATC 2 cut(s) 234, 699
DraI TTTAAA 1 cut(s) 66
Eco130I CCWWGG 1 cut(s) 287
Eco32I GATATC 1 cut(s) 283
Eco47I GGWCC 1 cut(s) 291
EcoO109I RGGNCCY 1 cut(s) 291
EcoRII CCWGG 1 cut(s) 645
EcoRV GATATC 1 cut(s) 283
EcoT14I CCWWGG 1 cut(s) 287
ErhI CCWWGG 1 cut(s) 287
FaeI CATG 1 cut(s) 137
FaiI YATR 5 cut(s) 135, 194, 398, 428, 563
FatI CATG 1 cut(s) 133
Fnu4HI GCNGC 3 cut(s) 330, 379, 576
Fsp4HI GCNGC 3 cut(s) 330, 379, 576
FspBI CTAG 2 cut(s) 44, 549
GlaI GCGC 1 cut(s) 418
GluI GCNGC 3 cut(s) 330, 379, 576
GsaI CCCAGC 1 cut(s) 106
GsuI CTGGAG 1 cut(s) 636
HapII CCGG 2 cut(s) 238, 697
HhaI GCGC 1 cut(s) 419
Hin1II CATG 1 cut(s) 137
Hin6I GCGC 1 cut(s) 417
HinP1I GCGC 1 cut(s) 417
HinfI GANTC 1 cut(s) 518
HpaII CCGG 2 cut(s) 238, 697
HphI GGTGA 1 cut(s) 661
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 4 cut(s) 7, 187, 542, 704
Hpy188III TCNNGA 2 cut(s) 134, 504
Hpy8I GTNNAC 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 78
HpyCH4V TGCA 5 cut(s) 381, 434, 524, 596, 662
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 215, 629
HpyF3I CTNAG 4 cut(s) 6, 107, 177, 539
Hsp92II CATG 1 cut(s) 137
HspAI GCGC 1 cut(s) 417
Kzo9I GATC 2 cut(s) 234, 699
LmnI GCTCC 1 cut(s) 620
Lsp1109I GCAGC 3 cut(s) 316, 365, 562
LweI GCATC 2 cut(s) 421, 632
MaeI CTAG 2 cut(s) 44, 549
MalI GATC 2 cut(s) 236, 701
MboI GATC 2 cut(s) 234, 699
MboII GAAGA 1 cut(s) 664
MluCI AATT 9 cut(s) 23, 60, 165, 273, 347, 480, 508, 513, 678
MlyI GAGTC 1 cut(s) 527
MnlI CCTC 7 cut(s) 51, 83, 130, 133, 135, 305, 611
MseI TTAA 4 cut(s) 65, 72, 441, 512
MspI CCGG 2 cut(s) 238, 697
MspR9I CCNGG 3 cut(s) 239, 647, 697
Mva1269I GAATGC 1 cut(s) 47
MvaI CCWGG 1 cut(s) 647
MwoI GCNNNNNNNGC 3 cut(s) 44, 215, 629
NciI CCSGG 2 cut(s) 239, 697
NdeII GATC 2 cut(s) 234, 699
NlaIII CATG 1 cut(s) 137
NlaIV GGNNCC 2 cut(s) 293, 387
NmeAIII GCCGAG 2 cut(s) 400, 476
NspV TTCGAA 1 cut(s) 635
PagI TCATGA 1 cut(s) 133
PctI GAATGC 1 cut(s) 47
PfoI TCCNGGA 2 cut(s) 237, 695
PkrI GCNGC 3 cut(s) 331, 380, 577
PleI GAGTC 1 cut(s) 526
PpsI GAGTC 1 cut(s) 526
PpuMI RGGWCCY 1 cut(s) 291
Psp5II RGGWCCY 1 cut(s) 291
Psp6I CCWGG 1 cut(s) 645
PspFI CCCAGC 1 cut(s) 102
PspGI CCWGG 1 cut(s) 645
PspN4I GGNNCC 2 cut(s) 293, 387
PspPI GGNCC 1 cut(s) 291
PspPPI RGGWCCY 1 cut(s) 291
RsaI GTAC 2 cut(s) 95, 231
RsaNI GTAC 2 cut(s) 94, 230
SaqAI TTAA 4 cut(s) 65, 72, 441, 512
SatI GCNGC 3 cut(s) 330, 379, 576
Sau3AI GATC 2 cut(s) 234, 699
Sau96I GGNCC 1 cut(s) 291
SchI GAGTC 1 cut(s) 527
ScrFI CCNGG 3 cut(s) 239, 647, 697
SfaNI GCATC 2 cut(s) 421, 632
SfcI CTRYAG 1 cut(s) 684
SfuI TTCGAA 1 cut(s) 635
SinI GGWCC 1 cut(s) 291
SmlI CTYRAG 1 cut(s) 446
SmoI CTYRAG 1 cut(s) 446
Sse9I AATT 9 cut(s) 23, 60, 165, 273, 347, 480, 508, 513, 678
SspI AATATT 1 cut(s) 302
SspMI CTAG 2 cut(s) 44, 549
StyD4I CCNGG 3 cut(s) 237, 645, 695
StyI CCWWGG 1 cut(s) 287
TaqI TCGA 2 cut(s) 297, 635
TasI AATT 9 cut(s) 23, 60, 165, 273, 347, 480, 508, 513, 678
Tru1I TTAA 4 cut(s) 65, 72, 441, 512
Tru9I TTAA 4 cut(s) 65, 72, 441, 512
TseI GCWGC 3 cut(s) 329, 378, 575
TspDTI ATGAA 3 cut(s) 209, 360, 621
TspGWI ACGGA 1 cut(s) 216
VpaK11BI GGWCC 1 cut(s) 291
XapI RAATTY 5 cut(s) 23, 60, 165, 347, 508
XspI CTAG 2 cut(s) 44, 549
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.