Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041965.1

Orthogroup ID

OG0006387

Physical Location & Seq

Genomic Coordinates Reverse (-)

241 .. 585

Gene Structure 345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041965.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

atgtttggagaaactgaatatgatccaaccaggcagtttggttcgattcctatagaggaacaacttgacgctcttgggagagctgttgattccggtaaggtcagatatgttggtctcagtaatgaaacggcatatggtgtgatgaagtttcttcaggtggctgaaagaggcactcaccttccaaagattgtatctgtgcaggttgtatcgcgtagtctgacctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

74

Amino Acids

8.17

Weight (kDa)

5.7

Isoelectric Point (pI)

32.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006387)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g24450 FvH4_2g24450 FvH4_2g24450 FvH4_2g24450 FvH4_2g24450 FvH4_2g24450
malus_domestica	MD03G1274000.v1.1 MD11G1296300.v1.1
prunus_persica	Prupe.1G022700_v2.0.a1 Prupe.3G229100_v2.0.a1 Prupe.3G229200_v2.0.a1 Prupe.7G125500_v2.0.a1 Prupe.8G162600_v2.0.a1 Prupe.8G250200_v2.0.a1
pyrus_communis	pycom03g21820
rosa_chinensis	RchiOBHm_Chr6g0292291
rosa_laevigata	RLG00000012045 RLG00000029263
rosa_multiflora	Rmu_sc0002993.1_g000019 Rmu_sc0041965.1_g000001
rosa_roxburghii	Rroxscaffold_7G00175240
rosa_rugosa	Rorug06G0225200
rosa_samantha	Rh6AG338600 Rh6BG345700 Rh6CG352800 Rh6DG338600
rosa_wichuraiana	Rw6G029470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	190
AccII	CGCG	1 cut(s)	211
AclWI	GGATC	1 cut(s)	17
AcuI	CTGAAG	1 cut(s)	137
AjnI	CCWGG	1 cut(s)	29
AluBI	AGCT	1 cut(s)	83
AluI	AGCT	1 cut(s)	83
Alw26I	GTCTC	1 cut(s)	119
AlwI	GGATC	1 cut(s)	17
AsuHPI	GGTGA	1 cut(s)	167
BceAI	ACGGC	1 cut(s)	144
BciT130I	CCWGG	1 cut(s)	31
BcoDI	GTCTC	1 cut(s)	119
BfmI	CTRYAG	1 cut(s)	51
BfuAI	ACCTGC	1 cut(s)	190
Bme1390I	CCNGG	1 cut(s)	31
BmrFI	CCNGG	1 cut(s)	31
BsaI	GGTCTC	1 cut(s)	119
BsaWI	WCCGGW	1 cut(s)	92
BseBI	CCWGG	1 cut(s)	31
BseMII	CTCAG	1 cut(s)	130
BsgI	GTGCAG	1 cut(s)	218
Bsh1236I	CGCG	1 cut(s)	211
BsiSI	CCGG	1 cut(s)	93
BsmAI	GTCTC	1 cut(s)	119
Bso31I	GGTCTC	1 cut(s)	119
Bsp143I	GATC	1 cut(s)	22
BspCNI	CTCAG	1 cut(s)	129
BspFNI	CGCG	1 cut(s)	211
BspMI	ACCTGC	1 cut(s)	190
BspPI	GGATC	1 cut(s)	17
BspTNI	GGTCTC	1 cut(s)	119
BssMI	GATC	1 cut(s)	22
Bst2UI	CCWGG	1 cut(s)	31
BstDEI	CTNAG	1 cut(s)	116
BstFNI	CGCG	1 cut(s)	211
BstKTI	GATC	1 cut(s)	25
BstMAI	GTCTC	1 cut(s)	119
BstMBI	GATC	1 cut(s)	22
BstNI	CCWGG	1 cut(s)	31
BstSCI	CCNGG	1 cut(s)	29
BstSFI	CTRYAG	1 cut(s)	51
BstUI	CGCG	1 cut(s)	211
BveI	ACCTGC	1 cut(s)	190
CseI	GACGC	1 cut(s)	77
CviJI	RGCY	2 cut(s)	83, 161
CviKI_1	RGCY	2 cut(s)	83, 161
DdeI	CTNAG	1 cut(s)	116
DpnI	GATC	1 cut(s)	24
DpnII	GATC	1 cut(s)	22
Eco31I	GGTCTC	1 cut(s)	119
Eco57I	CTGAAG	1 cut(s)	137
EcoRII	CCWGG	1 cut(s)	29
FaiI	YATR	5 cut(s)	21, 53, 108, 133, 135
FauNDI	CATATG	1 cut(s)	133
HapII	CCGG	1 cut(s)	93
HgaI	GACGC	1 cut(s)	77
HinfI	GANTC	2 cut(s)	46, 89
HpaII	CCGG	1 cut(s)	93
HphI	GGTGA	1 cut(s)	167
Hpy188I	TCNGA	2 cut(s)	104, 219
HpyAV	CCTTC	1 cut(s)	188
HpyCH4V	TGCA	1 cut(s)	199
HpyF3I	CTNAG	1 cut(s)	116
Kzo9I	GATC	1 cut(s)	22
LpnPI	CCDG	5 cut(s)	16, 43, 106, 140, 185
MalI	GATC	1 cut(s)	24
MboI	GATC	1 cut(s)	22
MboII	GAAGA	1 cut(s)	143
MmeI	TCCRAC	1 cut(s)	50
MnlI	CCTC	2 cut(s)	49, 161
MspI	CCGG	1 cut(s)	93
MspR9I	CCNGG	1 cut(s)	31
MvaI	CCWGG	1 cut(s)	31
MvnI	CGCG	1 cut(s)	211
NdeI	CATATG	1 cut(s)	133
NdeII	GATC	1 cut(s)	22
PfeI	GAWTC	2 cut(s)	46, 89
Psp6I	CCWGG	1 cut(s)	29
PspGI	CCWGG	1 cut(s)	29
Sau3AI	GATC	1 cut(s)	22
ScrFI	CCNGG	1 cut(s)	31
SetI	ASST	6 cut(s)	85, 102, 159, 180, 204, 224
SfcI	CTRYAG	1 cut(s)	51
SgeI	CNNG	7 cut(s)	42, 43, 77, 86, 105, 167, 212
StyD4I	CCNGG	1 cut(s)	29
TaqI	TCGA	1 cut(s)	44
TfiI	GAWTC	2 cut(s)	46, 89
TspDTI	ATGAA	2 cut(s)	138, 158

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.