Rmu_ssc0000110.1_g000011

NUMOD3 motif (2 copies)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000110.1
Physical Location & Seq
Reverse (-)
37458 .. 40222
2765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000110.1_g000011.1.cds

Sequence Viewer

Length: 888 bp
atggaattttgccggatcaatccaattaccccgagtaaaattgaaaaagagagtccaggcccaatccgagaaggccattacaggttattgcaaaacgggtctttctacttttctagttcgcctgctcactctcttatcttccaccttcaaatgccgttctttcacctgagattgtctgctccacattcaacccttgatcatgttccactgtttggttatgtggcggaagccaatcactttccacagaacacagagcatttgaattatcatttacgtgttctgaggaatcggtctccctcgtttgcctctgtctgttctttccctcaacttcattacattggagctatgcagatcagtgttggcatggatgagaaatgtgatattgctaacctcagccattctatagttagcagaaagccacgagagcagcaaaacgtaagaaaggaggttcagttaattggtcagaatgactctacagtaagtattagcaacgcagattacaaggaaagagaaagacgaaagaaaataggactagccaacaaaggaaaagtgccatggaacaaaggcaggaaacatagtgcagagacttgtgagcgcatcaagcgacaaaccatagaggccctaaaagaccccaaggtgaaggcatttccttttatcacatcaatgactaagcatttttgtgctagttgcaatagattgcgactcttagctgatgggaacttcaaagtttgcttatttgatctttcagaattccaacttcggcatgctgatgaccataaactaggggaaataattggttcagcggtgaagaggaagaaagcttcgcatgctggaatgtttgacaatgcaaagatagcaaatagacccatgatacatattggtggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

295

Amino Acids

33.57

Weight (kDa)

9.72

Isoelectric Point (pI)

49.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 212
AciI CCGC 2 cut(s) 224, 803
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 2 cut(s) 5, 749
AfiI CCNNNNNNNGG 1 cut(s) 212
AflIII ACRYGT 1 cut(s) 274
AgsI TTSAA 5 cut(s) 44, 149, 189, 262, 724
AjnI CCWGG 1 cut(s) 55
AluBI AGCT 3 cut(s) 344, 710, 821
AluI AGCT 3 cut(s) 344, 710, 821
Alw26I GTCTC 2 cut(s) 297, 578
AlwI GGATC 1 cut(s) 23
Ama87I CYCGRG 1 cut(s) 31
AoxI GGCC 3 cut(s) 58, 73, 618
ApeKI GCWGC 1 cut(s) 427
ApoI RAATTY 2 cut(s) 5, 749
AspLEI GCGC 1 cut(s) 597
AspS9I GGNCC 2 cut(s) 59, 619
AsuHPI GGTGA 3 cut(s) 155, 649, 817
AvaI CYCGRG 1 cut(s) 31
BauI CACGAG 1 cut(s) 420
BbvCI CCTCAGC 1 cut(s) 392
BbvI GCAGC 1 cut(s) 439
BccI CCATC 1 cut(s) 707
BceAI ACGGC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 57
BclI TGATCA 1 cut(s) 196
BcoDI GTCTC 2 cut(s) 297, 578
BfaI CTAG 4 cut(s) 114, 533, 684, 782
BfmI CTRYAG 2 cut(s) 402, 474
BisI GCNGC 1 cut(s) 428
BlsI GCNGC 1 cut(s) 429
Bme1390I CCNGG 1 cut(s) 57
BmeT110I CYCGRG 1 cut(s) 31
BmgT120I GGNCC 2 cut(s) 59, 619
BmrFI CCNGG 1 cut(s) 57
BmsI GCATC 1 cut(s) 606
Bpu10I CCTNAGC 1 cut(s) 392
BsaAI YACGTR 1 cut(s) 275
BsaI GGTCTC 1 cut(s) 297
BsaJI CCNNGG 2 cut(s) 554, 633
BsaXI ACNNNNNCTCC 2 cut(s) 437, 467
Bsc4I CCNNNNNNNGG 1 cut(s) 212
BseBI CCWGG 1 cut(s) 57
BseDI CCNNGG 2 cut(s) 554, 633
BseGI GGATG 1 cut(s) 373
BseLI CCNNNNNNNGG 1 cut(s) 212
BseMII CTCAG 3 cut(s) 158, 272, 406
BseXI GCAGC 1 cut(s) 439
BsgI GTGCAG 1 cut(s) 600
BshFI GGCC 3 cut(s) 60, 75, 620
BsiHKCI CYCGRG 1 cut(s) 31
BsiSI CCGG 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 212
BsmAI GTCTC 2 cut(s) 297, 578
BsnI GGCC 3 cut(s) 60, 75, 620
Bso31I GGTCTC 1 cut(s) 297
BsoBI CYCGRG 1 cut(s) 31
Bsp143I GATC 4 cut(s) 15, 196, 351, 739
Bsp19I CCATGG 1 cut(s) 554
BspACI CCGC 2 cut(s) 224, 803
BspANI GGCC 3 cut(s) 60, 75, 620
BspCNI CTCAG 3 cut(s) 159, 273, 405
BspPI GGATC 1 cut(s) 23
BspTNI GGTCTC 1 cut(s) 297
BssECI CCNNGG 2 cut(s) 554, 633
BssMI GATC 4 cut(s) 15, 196, 351, 739
BssSI CACGAG 1 cut(s) 420
BssT1I CCWWGG 2 cut(s) 554, 633
Bst2BI CACGAG 1 cut(s) 420
Bst2UI CCWGG 1 cut(s) 57
Bst4CI ACNGT 2 cut(s) 210, 478
Bst6I CTCTTC 1 cut(s) 803
BstBAI YACGTR 1 cut(s) 275
BstC8I GCNNGC 3 cut(s) 123, 765, 828
BstDEI CTNAG 5 cut(s) 167, 281, 392, 669, 706
BstDSI CCRYGG 1 cut(s) 554
BstF5I GGATG 1 cut(s) 373
BstHHI GCGC 1 cut(s) 597
BstKTI GATC 4 cut(s) 18, 199, 354, 742
BstMAI GTCTC 2 cut(s) 297, 578
BstMBI GATC 4 cut(s) 15, 196, 351, 739
BstMWI GCNNNNNNNGC 4 cut(s) 424, 601, 827, 854
BstNI CCWGG 1 cut(s) 57
BstNSI RCATGY 2 cut(s) 767, 830
BstSCI CCNGG 1 cut(s) 55
BstSFI CTRYAG 2 cut(s) 402, 474
BstV1I GCAGC 1 cut(s) 439
BsuRI GGCC 3 cut(s) 60, 75, 620
BtgI CCRYGG 1 cut(s) 554
BtsCI GGATG 1 cut(s) 373
BtsIMutI CAGTG 2 cut(s) 206, 361
Cac8I GCNNGC 3 cut(s) 123, 765, 828
CfoI GCGC 1 cut(s) 597
Cfr13I GGNCC 2 cut(s) 59, 619
CviAII CATG 6 cut(s) 200, 364, 555, 764, 827, 868
DdeI CTNAG 5 cut(s) 167, 281, 392, 669, 706
DpnI GATC 4 cut(s) 17, 198, 353, 741
DpnII GATC 4 cut(s) 15, 196, 351, 739
Eam1104I CTCTTC 1 cut(s) 803
EarI CTCTTC 1 cut(s) 803
EciI GGCGGA 1 cut(s) 239
Eco130I CCWWGG 2 cut(s) 554, 633
Eco31I GGTCTC 1 cut(s) 297
Eco88I CYCGRG 1 cut(s) 31
EcoO109I RGGNCCY 1 cut(s) 619
EcoRI GAATTC 1 cut(s) 749
EcoRII CCWGG 1 cut(s) 55
EcoT14I CCWWGG 2 cut(s) 554, 633
ErhI CCWWGG 2 cut(s) 554, 633
FaeI CATG 6 cut(s) 203, 367, 558, 767, 830, 871
FatI CATG 6 cut(s) 199, 363, 554, 763, 826, 867
FbaI TGATCA 1 cut(s) 196
Fnu4HI GCNGC 1 cut(s) 428
FokI GGATG 1 cut(s) 380
Fsp4HI GCNGC 1 cut(s) 428
FspBI CTAG 4 cut(s) 114, 533, 684, 782
GlaI GCGC 1 cut(s) 596
GluI GCNGC 1 cut(s) 428
HaeIII GGCC 3 cut(s) 60, 75, 620
HapII CCGG 1 cut(s) 13
HhaI GCGC 1 cut(s) 597
Hin1II CATG 6 cut(s) 203, 367, 558, 767, 830, 871
Hin6I GCGC 1 cut(s) 595
HinP1I GCGC 1 cut(s) 595
HindIII AAGCTT 1 cut(s) 819
HinfI GANTC 4 cut(s) 52, 286, 470, 702
HpaII CCGG 1 cut(s) 13
HphI GGTGA 3 cut(s) 155, 649, 817
Hpy188I TCNGA 4 cut(s) 68, 282, 465, 748
HpyAV CCTTC 3 cut(s) 65, 155, 634
HpyCH4III ACNGT 2 cut(s) 210, 478
HpyCH4IV ACGT 2 cut(s) 274, 435
HpyCH4V TGCA 5 cut(s) 91, 349, 581, 690, 848
HpyF10VI GCNNNNNNNGC 4 cut(s) 424, 601, 827, 854
HpyF3I CTNAG 5 cut(s) 167, 281, 392, 669, 706
HpySE526I ACGT 2 cut(s) 274, 435
Hsp92II CATG 6 cut(s) 203, 367, 558, 767, 830, 871
HspAI GCGC 1 cut(s) 595
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 4 cut(s) 15, 196, 351, 739
LmnI GCTCC 2 cut(s) 184, 341
LpnPI CCDG 8 cut(s) 26, 42, 67, 69, 135, 179, 553, 816
Lsp1109I GCAGC 1 cut(s) 439
LweI GCATC 1 cut(s) 606
MaeI CTAG 4 cut(s) 114, 533, 684, 782
MaeII ACGT 2 cut(s) 274, 435
MalI GATC 4 cut(s) 17, 198, 353, 741
MboI GATC 4 cut(s) 15, 196, 351, 739
MboII GAAGA 3 cut(s) 130, 820, 826
MluCI AATT 7 cut(s) 5, 24, 39, 262, 456, 749, 792
MlyI GAGTC 3 cut(s) 61, 464, 696
MmeI TCCRAC 1 cut(s) 778
MnlI CCTC 8 cut(s) 276, 307, 316, 333, 401, 439, 610, 804
MseI TTAA 2 cut(s) 455, 886
MslI CAYNNNNRTG 5 cut(s) 273, 662, 678, 768, 879
MspA1I CMGCKG 1 cut(s) 803
MspI CCGG 1 cut(s) 13
MspR9I CCNGG 1 cut(s) 57
MvaI CCWGG 1 cut(s) 57
MwoI GCNNNNNNNGC 4 cut(s) 424, 601, 827, 854
NcoI CCATGG 1 cut(s) 554
NdeII GATC 4 cut(s) 15, 196, 351, 739
NlaIII CATG 6 cut(s) 203, 367, 558, 767, 830, 871
NspI RCATGY 2 cut(s) 767, 830
PaeI GCATGC 2 cut(s) 767, 830
PfeI GAWTC 1 cut(s) 286
PflMI CCANNNNNTGG 1 cut(s) 212
PkrI GCNGC 1 cut(s) 429
PleI GAGTC 3 cut(s) 60, 464, 696
PpsI GAGTC 3 cut(s) 60, 464, 696
Ppu21I YACGTR 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 55
PspGI CCWGG 1 cut(s) 55
PspPI GGNCC 2 cut(s) 59, 619
RseI CAYNNNNRTG 5 cut(s) 273, 662, 678, 768, 879
SaqAI TTAA 2 cut(s) 455, 886
SatI GCNGC 1 cut(s) 428
Sau3AI GATC 4 cut(s) 15, 196, 351, 739
Sau96I GGNCC 2 cut(s) 59, 619
SchI GAGTC 3 cut(s) 61, 464, 696
ScrFI CCNGG 1 cut(s) 57
SfaNI GCATC 1 cut(s) 606
SfcI CTRYAG 2 cut(s) 402, 474
SmiMI CAYNNNNRTG 5 cut(s) 273, 662, 678, 768, 879
SphI GCATGC 2 cut(s) 767, 830
Sse9I AATT 7 cut(s) 5, 24, 39, 262, 456, 749, 792
SsiI CCGC 2 cut(s) 224, 803
SspMI CTAG 4 cut(s) 114, 533, 684, 782
StyD4I CCNGG 1 cut(s) 55
StyI CCWWGG 2 cut(s) 554, 633
TaaI ACNGT 2 cut(s) 210, 478
TaiI ACGT 2 cut(s) 277, 438
TaqII GACCGA 1 cut(s) 279
TasI AATT 7 cut(s) 5, 24, 39, 262, 456, 749, 792
TfiI GAWTC 1 cut(s) 286
Tru1I TTAA 2 cut(s) 455, 886
Tru9I TTAA 2 cut(s) 455, 886
TscAI CASTG 2 cut(s) 213, 361
TseI GCWGC 1 cut(s) 427
TspDTI ATGAA 1 cut(s) 320
TspRI CASTG 2 cut(s) 213, 361
Van91I CCANNNNNTGG 1 cut(s) 212
XapI RAATTY 2 cut(s) 5, 749
XceI RCATGY 2 cut(s) 767, 830
XspI CTAG 4 cut(s) 114, 533, 684, 782
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.