Rmu_ssc0000358.1_g000009

Clustered mitochondria protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000358.1
OG0007431
Physical Location & Seq
Forward (+)
40807 .. 51941
11135 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 5553 bp
atggcacccagaaacagtcgtggaaagggcaaaggtggagagaagaagaagaaggaagagaaggttcttcctgttgtgatggacatcactgtgaaccttccagatgaaagcagtgttgttttgaagcagggaatatcgacggacaggatcatcgacgttcgccaactattatcagtcaacacagaaacttgtaacatcaccaatttttcactatcccatgaggtaagagggaaacgtttaaaagatacggtggacgtctccgcactcaagccatgcgtcatcaccttggtcgaagaggactatgatgaagagcgcgccaccgcgcacgtgcggcgcgtgctggacatcgtggcctgcacgacgagctttggcgcgtcaccgacgcctccgccgactccggcgaaggaccaaggcctcaagcccgacgcctcgtccgcagtcctctccggtaaaaatgcgcaggataataagaccgccaagaaatccaccgccacctccaccgcggcggcggccaagtctcaaggctctgccggagccgataagcgtgacgtggcggtcgactcggacgccgagctgagccactcttgcctcaagctcggttctttctacgacttcttctctctcgctcatctcactcccccgctgcaatttatccgaagggtgacgaaacgacatgtcgatgagatttccggcgatgatcacctgttttctcttgaagtgaagctttgcaatgggaaggtggttctggttgaagcttgcagaaagggattctatagtgtagggaagcagcgcattctgtgtcacaacctcgtcgatttgctacgccagcttagtagagcttttgacagtgcttacgatgatctgctgaaagcattttcggaacgtaataagtttgggaatcttccctatggctttcgagcaaacacatggcttgtaccgcctattgcagggcagtcgccttcaggtttccctgctcttcctgtggaggatgaagcttggggaggaaatggagggggtctaggaagggatgggcaatttgatctgattccttgggctaatgagttttggtgtattgcatctatgccttgcaagacggcggaggagaggcaggttcgagataggaaggcattccttcttcacagcctatttgtcgacgtttccatttttagagccattaaggctgtgcagcatgtgatggcaaagccggaattaacatgttcagctgcaaacagtgaggttctttatactgagagagtaggggacttgaatgtgatagtaacaaaggatgttaacaatgcgagctgtaaggtggatactaaaattgatggaattcaggcaactggagtggataaaaagaatctagcacaacgaaaccttcttaaagggatcactgctgatgagaacaccgctgcacatgatgtcaccactcttggtgttgtcaatgtccgatattgtggtcacattgcagttgtgaaagttgagggcaaagaaactaagaaagtcagttctccatcccaaagcattgacctccttgatcaacctgaaggtggtgccaatgcccttaatatcaacagtttgagattactacttcacactactacaccttcagagcagaataaactggcatcacatgggcaaggtctggaacatgaagtgctttctgcttcctgcgcttttgttgagaagctattagaagaaagtcttgctaagcttgacaaagaggagctagattctgatagttttgtgagatgggaactaggagcttgctggatacaacacttgcaagaccaaaaaaatacagacaaggataagaaaccattgggtgagaaggctaagaatgagatgaaggtcgagggacttgggacacctcttaaatcccttaagaacacgaagaagaaatcagatggagccaatattaaagtgcagtctgatagctcaaagtcgcatgcagatggtgttgtgggagaagtagaaaatgctataggttctgtggaatcaaagtttgaaaccagtgctaaagaaaatgagcttgtgctgacagagatgctctctgacgcagcctttgctcgactaaaagaatcagaaactggacttcattgcaagtctctgcaagaactgatcgacttatctcagaagtattactctgaagttgctcttccaaaactggtagccgattttggttcattggaactttcaccagttgatggtcgaactttaactgatttcatgcatactagaggtcttcggatgcgttctctggggcaagttgtcaagctatcagagaagctatcacatgtgcagtccctttgtattcatgagatgatagtgcgagcttttaagcatatacttcaggcagtgattgctgctgttaatgacactgagaaaatggctgcctcgattgctgctgcattgaatcttatgttgggggctccagaaaatgaagaattcaataagtctttcaatgtgcattcccttgtgtggagatggctggaattattcttgcgaaagagatatggatgggatgttagcagcttcaactacaatgatgtgaggagatttgcgattctacgtggcctgtgtcataaggtgggcattgagatggttccacgagattttgatatggagtctccaaatccatttcagagttctgatattgtcagcttagttccagtacataagcaagctgcatgctcttcggcagatggtaggcaactattggagtcatcaaaaacagccttagacaagggaaaacttgaagatgcagttgcatatggcactaaggctcttgcaaagctggtagcagtttgtggtccataccatcgaatgacagcaggagcttacagccttcttgctgtagttttatatcacactggggattttaatcaggctacaatttatcagcaaaaggctctggatatcaatgagagagaattagggcttgaccatccagacaccatgaagagttatggggatcttgctgtgttctattacagacttcaacatacagagctggctctcaaatatgtaaaacgtgctctgtatctcttgcatctcacatgtggaccatctcacccaaacactgctgcaacatacatcaacgtggctatgatggaagaaggcctgggaaatgtacatgttgccctcagatatctacacaaggctttaaagtcataccctttaagtgttcagcatgagcagacaacattgcaaattctgcgtgcaaagcttggaccagatgatctacgtacacaagatgctgctgcctggcttgagtactttgagtccaaggcttttgaacagcaagaagctgcaagaaatgggactcgaaaaccagatgcatctatagccagcaaaggccacttaagcgtatcagatttgcttgactacatcaatcccactgatgatgctaaagggagagatgcggcaatgaagaggaaaacctacataacaaagttgaaggaaaaatcctatcaaactatcagctcagcaagttctgacgaatcttcaaaagaaaccacaaaagaggtttcagacgaagaaacacatacacttgaaccaagagaaagaacagatcccatccaagaaaacatcccggcttcagttgaaccccagcatgttgtagaagagattcctgaggaaaattcaaacatgagctcttctgaaacacatgttgaaggggaagatgactggcaaccagttcaaaggcctagatcagcgggttcatatgggcggcgtgtaaaacagcggcgggcagctattgggaaggtttatagttaccagaagaaatatgtagatgctgatatggattacccttcagtgaagaatactaaccaaaacagtaggtattacctgctaaagaaaaggccaacatctcatggaagttatacagaaaatcagattgcgaatccctcccaaggtactaaatttggacggagaatggtaaaagctgtagcatacagagtcaagtctatgcctttgtctaccaaagtcgttgcagcagaaagtttgagttcctcatcagaagtcagtccaaatgtttcaccacatgggattggtccagttaaaggttctatagtcagtcttggaaaatctccttcatacaaggaagtagcattggctccaccaggtagtattgctaaaatgcaaactgttttccctcagaatgtcattccagataaccatgagcatggtatccaaagacaagaagaggaaataattgaaatcaaaggagattccaaaccaaaggctgtagttgaaactatacttgaagaaaagaaggatcctgtattggtttccacagatgtgttacgagagcaaactggacctgttgagaagaaagaagatactaattcacctgaagtgaaggaagataaaaattcactgatattcgggaccgtggatgaacttggatccagtgctgttaagtttcaagaggcagcagttgataacgtattagtagatggactgccaaaatccattgattctgccaaggagggactctgtgagaacaatccatctggcacttctgaattgcatgattccaactccactttgcaaggagtagatgatttggaggcatccttgcttgttacttcagctgatactcggggattgccaaataagaagttatctgcatcggcagctccattcaatccctcaccatccactcgtgctgctccggttcccatgaacattgctataccttctggtgcgggttctgtcccaactattgcaccttggccagtaaacctgaatattcacccaggggcagctactgtcttacccacagttaatcccatgtgctcctctcctcatcatccatacccttctccccctgctactccgaatatcatacagccattgccatttatgttccctcctccttacagtcaaccccaagttgtacgaaccagtacctttcctgtgactagtgcgtttcatccaaatcattacacatggcagtgcaatgtgaatcctaatgtatccgagtttgtacctacaacagtttggcatggttgccatccaatggaattctctgccccagcacctgttgttgagccaatttctgatccctctcccttggagtcaaaaattcagaacgatgattctgctccagttctgccagtggacattggtaatgtgggggaaactaagaaagaagcggacattctaacatcagaggcaacttgcaatccaattgaaagtgtcaaggaagttggtccagatctttgtggggttgagaatgctcagaacgaaccatgtgacagcccaaatggaaaagttggaagtagcgctgaaaggatgactgatggagagaaaaccttcagcattttgataaggggcagaagaaaccgaaagcagactctgagaatgccagtaagtttgctcagtcgaccatatggctcacaaagggacaggattcacttgatcccttggctcttacattcacaaccttgtgatattctacttatacatggttggcgtaaaagagttcaggttacagtaggaagctcacttttgttggaacttccatggggagagtttatggggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CLU_N TPR_12 eIF3_p135

Protein Analysis

1850

Amino Acids

202.92

Weight (kDa)

6.33

Isoelectric Point (pI)

43.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CLU_N PF15044 47 - 117 9.2e-11 Mitochondrial function, CLU-N-term
eIF3_p135 PF12807 731 - 873 2.7e-24 Translation initiation factor eIF3 subunit 135
TPR_12 PF13424 913 - 975 2.3e-07 Tetratricopeptide repeat
TPR_NPHP3 PF24885 915 - 1014 1.7e-07 Nephrocystin-3 TPR domain
TPR_12 PF13424 943 - 1013 2.1e-12 Tetratricopeptide repeat
TPR_10 PF13374 943 - 984 2.1e-09 Tetratricopeptide repeat
TPR_12 PF13424 985 - 1058 1.3e-09 Tetratricopeptide repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 554
AatII GACGTC 1 cut(s) 258
Acc16I TGCGCA 1 cut(s) 459
Acc36I ACCTGC 2 cut(s) 1099, 3858
AccB1I GGYRCC 2 cut(s) 4, 1550
AccB7I CCANNNNNTGG 2 cut(s) 2204, 5026
AccI GTMKAC 4 cut(s) 558, 1152, 3980, 5392
AccII CGCG 5 cut(s) 315, 323, 336, 374, 503
AclI AACGTT 1 cut(s) 235
AcoI YGGCCR 2 cut(s) 510, 4739
AcsI RAATTY 8 cut(s) 1329, 2444, 3210, 3640, 3923, 4375, 5030, 5091
AcvI CACGTG 1 cut(s) 328
AcyI GRCGYC 4 cut(s) 255, 383, 426, 567
AfaI GTAC 9 cut(s) 936, 2673, 3132, 3247, 3275, 3919, 4905, 4915, 4995
AfeI AGCGCT 1 cut(s) 5293
AfiI CCNNNNNNNGG 7 cut(s) 947, 1547, 2204, 2478, 3914, 4064, 5026
AflII CTTAAG 2 cut(s) 1880, 3361
AflIII ACRYGT 6 cut(s) 673, 1214, 2293, 3056, 3133, 3667
AhdI GACNNNNNGTC 1 cut(s) 430
AhlI ACTAGT 1 cut(s) 4928
AjiI CACGTC 1 cut(s) 550
AjnI CCWGG 4 cut(s) 3120, 3263, 4123, 4762
AjuI GAANNNNNNNTTGG 2 cut(s) 2405, 2437
AleI CACNNNNGTG 1 cut(s) 4301
Alw21I GWGCWC 3 cut(s) 3037, 3656, 4805
Alw26I GTCTC 4 cut(s) 262, 522, 2109, 2631
AlwNI CAGNNNCTG 4 cut(s) 2087, 4775, 5048, 5365
Ama87I CYCGRG 1 cut(s) 4605
Aor51HI AGCGCT 1 cut(s) 5293
AoxI GGCC 9 cut(s) 351, 412, 510, 2572, 3118, 3355, 3704, 3863, 4739
ApoI RAATTY 8 cut(s) 1329, 2444, 3210, 3640, 3923, 4375, 5030, 5091
ArsI GACNNNNNNTTYG 2 cut(s) 2045, 2077
Asp700I GAANNNNTTC 3 cut(s) 1127, 3627, 5321
AspLEI GCGC 9 cut(s) 315, 317, 325, 336, 374, 460, 792, 1673, 5294
AspS9I GGNCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
AsuC2I CCSGG 1 cut(s) 3593
AvaI CYCGRG 1 cut(s) 4605
AvaII GGWCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
AxyI CCTNAGG 1 cut(s) 3633
BalI TGGCCA 1 cut(s) 4741
BamHI GGATCC 2 cut(s) 4279, 4409
BanI GGYRCC 2 cut(s) 4, 1550
BanII GRGCYC 2 cut(s) 2431, 3656
BauI CACGAG 2 cut(s) 2607, 4668
BbrPI CACGTG 1 cut(s) 328
BbsI GAAGAC 1 cut(s) 2234
Bbv12I GWGCWC 3 cut(s) 3037, 3656, 4805
BceAI ACGGC 1 cut(s) 1110
BcgI CGANNNNNNTGC 6 cut(s) 936, 970, 2676, 2710, 5090, 5124
BciT130I CCWGG 4 cut(s) 3122, 3265, 4125, 4764
BciVI GTATCC 4 cut(s) 1306, 1764, 4202, 4993
BclI TGATCA 2 cut(s) 697, 1534
BcnI CCSGG 1 cut(s) 3593
BcoDI GTCTC 4 cut(s) 262, 522, 2109, 2631
BcuI ACTAGT 1 cut(s) 4928
BfaI CTAG 7 cut(s) 1019, 1361, 1727, 1757, 2235, 3708, 4929
BfmI CTRYAG 7 cut(s) 772, 1980, 2853, 3342, 3948, 4071, 4248
BfoI RGCGCY 1 cut(s) 5295
BfrI CTTAAG 2 cut(s) 1880, 3361
BfuAI ACCTGC 2 cut(s) 1099, 3858
BfuI GTATCC 4 cut(s) 1306, 1764, 4202, 4993
BglI GCCNNNNNGGC 1 cut(s) 1178
BglII AGATCT 1 cut(s) 5224
BlpI GCTNAGC 3 cut(s) 575, 1707, 3484
BmcAI AGTACT 1 cut(s) 3275
Bme1390I CCNGG 5 cut(s) 3122, 3265, 3593, 4125, 4764
Bme18I GGWCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
BmeRI GACNNNNNGTC 1 cut(s) 430
BmeT110I CYCGRG 1 cut(s) 4605
BmgBI CACGTC 1 cut(s) 550
BmgT120I GGNCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
BmrFI CCNGG 5 cut(s) 3122, 3265, 3593, 4125, 4764
BmrI ACTGGG 1 cut(s) 2880
BmuI ACTGGG 1 cut(s) 2880
BpiI GAAGAC 1 cut(s) 2234
BplI GAGNNNNNCTC 2 cut(s) 2033, 2065
BpmI CTGGAG 3 cut(s) 1362, 2415, 5097
Bpu1102I GCTNAGC 3 cut(s) 575, 1707, 3484
BpuEI CTTGAG 5 cut(s) 251, 401, 504, 575, 3290
BpuMI CCSGG 1 cut(s) 3593
BsaAI YACGTR 3 cut(s) 328, 2570, 3245
BsaBI GATNNNNATC 2 cut(s) 83, 2880
BsaHI GRCGYC 4 cut(s) 255, 383, 426, 567
BsaWI WCCGGW 2 cut(s) 446, 4678
Bsc4I CCNNNNNNNGG 7 cut(s) 947, 1547, 2204, 2478, 3914, 4064, 5026
Bse21I CCTNAGG 1 cut(s) 3633
Bse3DI GCAATG 8 cut(s) 736, 1461, 2095, 3203, 3432, 4692, 4859, 4972
Bse8I GATNNNNATC 2 cut(s) 83, 2880
BseBI CCWGG 4 cut(s) 3122, 3265, 4125, 4764
BseJI GATNNNNATC 2 cut(s) 83, 2880
BseLI CCNNNNNNNGG 7 cut(s) 947, 1547, 2204, 2478, 3914, 4064, 5026
BseMI GCAATG 8 cut(s) 736, 1461, 2095, 3203, 3432, 4692, 4859, 4972
BsePI GCGCGC 1 cut(s) 313
BseRI GAGGAG 6 cut(s) 1115, 1736, 2566, 4795, 4800, 4869
BseYI CCCAGC 2 cut(s) 3609, 5041
BsgI GTGCAG 5 cut(s) 340, 1205, 1395, 1943, 2318
Bsh1236I CGCG 5 cut(s) 315, 323, 336, 374, 503
Bsh1285I CGRYCG 1 cut(s) 558
BshFI GGCC 9 cut(s) 353, 414, 512, 2574, 3120, 3357, 3706, 3865, 4741
BshNI GGYRCC 2 cut(s) 4, 1550
BsiEI CGRYCG 1 cut(s) 558
BsiHKAI GWGCWC 3 cut(s) 3037, 3656, 4805
BsiHKCI CYCGRG 1 cut(s) 4605
BsiSI CCGG 7 cut(s) 398, 447, 531, 690, 1205, 3593, 4679
BslFI GGGAC 9 cut(s) 1274, 1869, 1876, 2287, 3334, 4405, 4509, 4706, 5426
BslI CCNNNNNNNGG 7 cut(s) 947, 1547, 2204, 2478, 3914, 4064, 5026
BsmAI GTCTC 4 cut(s) 262, 522, 2109, 2631
BsmBI CGTCTC 1 cut(s) 262
BsmFI GGGAC 9 cut(s) 1274, 1869, 1876, 2287, 3334, 4405, 4509, 4706, 5426
BsmI GAATGC 5 cut(s) 792, 1127, 2467, 5248, 5376
BsnI GGCC 9 cut(s) 353, 414, 512, 2574, 3120, 3357, 3706, 3865, 4741
BsoBI CYCGRG 1 cut(s) 4605
Bsp1286I GDGCHC 4 cut(s) 2431, 3037, 3656, 4805
Bsp1407I TGTACA 1 cut(s) 3130
Bsp1720I GCTNAGC 3 cut(s) 575, 1707, 3484
Bsp19I CCATGG 1 cut(s) 5531
BspANI GGCC 9 cut(s) 353, 414, 512, 2574, 3120, 3357, 3706, 3865, 4741
BspFNI CGCG 5 cut(s) 315, 323, 336, 374, 503
BspHI TCATGA 1 cut(s) 2314
BspMI ACCTGC 2 cut(s) 1099, 3858
BspQI GCTCTTC 5 cut(s) 303, 981, 2160, 2698, 3661
BspT107I GGYRCC 2 cut(s) 4, 1550
BspTI CTTAAG 2 cut(s) 1880, 3361
BsrDI GCAATG 8 cut(s) 736, 1461, 2095, 3203, 3432, 4692, 4859, 4972
BsrGI TGTACA 1 cut(s) 3130
BssHII GCGCGC 1 cut(s) 313
BssNI GRCGYC 4 cut(s) 255, 383, 426, 567
BssSI CACGAG 2 cut(s) 2607, 4668
Bst2BI CACGAG 2 cut(s) 2607, 4668
Bst2UI CCWGG 4 cut(s) 3122, 3265, 4125, 4764
BstACI GRCGYC 4 cut(s) 255, 383, 426, 567
BstAFI CTTAAG 2 cut(s) 1880, 3361
BstAPI GCANNNNNTGC 3 cut(s) 2063, 2360, 3214
BstAUI TGTACA 1 cut(s) 3130
BstBAI YACGTR 3 cut(s) 328, 2570, 3245
BstDSI CCRYGG 3 cut(s) 501, 4395, 5531
BstENI CCTNNNNNAGG 1 cut(s) 945
BstFNI CGCG 5 cut(s) 315, 323, 336, 374, 503
BstH2I RGCGCY 1 cut(s) 5295
BstHHI GCGC 9 cut(s) 315, 317, 325, 336, 374, 460, 792, 1673, 5294
BstMAI GTCTC 4 cut(s) 262, 522, 2109, 2631
BstMCI CGRYCG 1 cut(s) 558
BstNI CCWGG 4 cut(s) 3122, 3265, 4125, 4764
BstSCI CCNGG 5 cut(s) 3120, 3263, 3591, 4123, 4762
BstSFI CTRYAG 7 cut(s) 772, 1980, 2853, 3342, 3948, 4071, 4248
BstSNI TACGTA 1 cut(s) 3245
BstUI CGCG 5 cut(s) 315, 323, 336, 374, 503
BstV2I GAAGAC 1 cut(s) 2234
BstX2I RGATCY 5 cut(s) 2971, 3571, 4279, 4409, 5224
BstXI CCANNNNNNTGG 1 cut(s) 4187
BstYI RGATCY 5 cut(s) 2971, 3571, 4279, 4409, 5224
Bsu36I CCTNAGG 1 cut(s) 3633
BsuI GTATCC 4 cut(s) 1306, 1764, 4202, 4993
BsuRI GGCC 9 cut(s) 353, 414, 512, 2574, 3120, 3357, 3706, 3865, 4741
BtgI CCRYGG 3 cut(s) 501, 4395, 5531
BtgZI GCGATG 1 cut(s) 708
BtrI CACGTC 1 cut(s) 550
BtsI GCAGTG 5 cut(s) 118, 1389, 2361, 3078, 4967
BveI ACCTGC 2 cut(s) 1099, 3858
CaiI CAGNNNCTG 4 cut(s) 2087, 4775, 5048, 5365
CciI TCATGA 1 cut(s) 2314
CfoI GCGC 9 cut(s) 315, 317, 325, 336, 374, 460, 792, 1673, 5294
Cfr13I GGNCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
Cfr42I CCGCGG 1 cut(s) 504
CseI GACGC 6 cut(s) 265, 363, 391, 434, 575, 2063
CsiI ACCWGGT 1 cut(s) 4123
Csp6I GTAC 9 cut(s) 935, 2672, 3131, 3246, 3274, 3918, 4904, 4914, 4994
CspCI CAANNNNNGTGG 2 cut(s) 1326, 1361
CviQI GTAC 9 cut(s) 935, 2672, 3131, 3246, 3274, 3918, 4904, 4914, 4994
DraI TTTAAA 2 cut(s) 240, 3165
DrdI GACNNNNNNGTC 1 cut(s) 554
DriI GACNNNNNGTC 1 cut(s) 430
DseDI GACNNNNNNGTC 1 cut(s) 554
EaeI YGGCCR 2 cut(s) 510, 4739
Eam1105I GACNNNNNGTC 1 cut(s) 430
EciI GGCGGA 2 cut(s) 378, 1112
Ecl136II GAGCTC 1 cut(s) 3654
Eco105I TACGTA 1 cut(s) 3245
Eco147I AGGCCT 3 cut(s) 414, 3120, 3706
Eco24I GRGCYC 2 cut(s) 2431, 3656
Eco32I GATATC 2 cut(s) 2917, 3149
Eco47I GGWCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
Eco47III AGCGCT 1 cut(s) 5293
Eco53kI GAGCTC 1 cut(s) 3654
Eco72I CACGTG 1 cut(s) 328
Eco81I CCTNAGG 1 cut(s) 3633
Eco88I CYCGRG 1 cut(s) 4605
EcoICRI GAGCTC 1 cut(s) 3654
EcoNI CCTNNNNNAGG 1 cut(s) 945
EcoRI GAATTC 3 cut(s) 1329, 2444, 5030
EcoRII CCWGG 4 cut(s) 3120, 3263, 4123, 4762
EcoRV GATATC 2 cut(s) 2917, 3149
EcoT22I ATGCAT 2 cut(s) 2232, 3340
EcoT38I GRGCYC 2 cut(s) 2431, 3656
Esp3I CGTCTC 1 cut(s) 262
FalI AAGNNNNNCTT 6 cut(s) 708, 740, 1686, 1718, 2139, 2171
FaqI GGGAC 9 cut(s) 1274, 1869, 1876, 2287, 3334, 4405, 4509, 4706, 5426
FauI CCCGC 4 cut(s) 648, 3709, 3741, 4705
FauNDI CATATG 3 cut(s) 2770, 3724, 5398
FbaI TGATCA 2 cut(s) 697, 1534
FblI GTMKAC 4 cut(s) 558, 1152, 3980, 5392
FriOI GRGCYC 2 cut(s) 2431, 3656
FspBI CTAG 7 cut(s) 1019, 1361, 1727, 1757, 2235, 3708, 4929
FspI TGCGCA 1 cut(s) 459
GlaI GCGC 9 cut(s) 314, 316, 324, 335, 373, 459, 791, 1672, 5293
GsaI CCCAGC 2 cut(s) 3613, 5045
GsuI CTGGAG 3 cut(s) 1362, 2415, 5097
HaeII RGCGCY 1 cut(s) 5295
HaeIII GGCC 9 cut(s) 353, 414, 512, 2574, 3120, 3357, 3706, 3865, 4741
HapII CCGG 7 cut(s) 398, 447, 531, 690, 1205, 3593, 4679
HgaI GACGC 6 cut(s) 265, 363, 391, 434, 575, 2063
HhaI GCGC 9 cut(s) 315, 317, 325, 336, 374, 460, 792, 1673, 5294
Hin1I GRCGYC 4 cut(s) 255, 383, 426, 567
Hin6I GCGC 9 cut(s) 313, 315, 323, 334, 372, 458, 790, 1671, 5292
HinP1I GCGC 9 cut(s) 313, 315, 323, 334, 372, 458, 790, 1671, 5292
HincII GTYRAC 6 cut(s) 178, 559, 1153, 1291, 4892, 5393
HindII GTYRAC 6 cut(s) 178, 559, 1153, 1291, 4892, 5393
HindIII AAGCTT 5 cut(s) 722, 753, 993, 1709, 3224
HpaI GTTAAC 1 cut(s) 1291
HpaII CCGG 7 cut(s) 398, 447, 531, 690, 1205, 3593, 4679
Hpy99I CGWCG 7 cut(s) 142, 158, 364, 385, 428, 815, 1157
Hsp92I GRCGYC 4 cut(s) 255, 383, 426, 567
HspAI GCGC 9 cut(s) 313, 315, 323, 334, 372, 458, 790, 1671, 5292
Ksp22I TGATCA 2 cut(s) 697, 1534
KspAI GTTAAC 1 cut(s) 1291
KspI CCGCGG 1 cut(s) 504
LguI GCTCTTC 5 cut(s) 303, 981, 2160, 2698, 3661
MabI ACCWGGT 1 cut(s) 4123
MaeI CTAG 7 cut(s) 1019, 1361, 1727, 1757, 2235, 3708, 4929
MfeI CAATTG 1 cut(s) 5196
MflI RGATCY 5 cut(s) 2971, 3571, 4279, 4409, 5224
MhlI GDGCHC 4 cut(s) 2431, 3037, 3656, 4805
MlsI TGGCCA 1 cut(s) 4741
MluNI TGGCCA 1 cut(s) 4741
MmeI TCCRAC 3 cut(s) 4566, 5263, 5502
Mox20I TGGCCA 1 cut(s) 4741
Mph1103I ATGCAT 2 cut(s) 2232, 3340
MroXI GAANNNNTTC 3 cut(s) 1127, 3627, 5321
MscI TGGCCA 1 cut(s) 4741
MslI CAYNNNNRTG 8 cut(s) 89, 678, 1950, 2597, 3098, 4185, 4301, 4960
Msp20I TGGCCA 1 cut(s) 4741
MspA1I CMGCKG 7 cut(s) 503, 643, 1223, 1409, 3716, 3745, 4598
MspCI CTTAAG 2 cut(s) 1880, 3361
MspI CCGG 7 cut(s) 398, 447, 531, 690, 1205, 3593, 4679
MspR9I CCNGG 5 cut(s) 3122, 3265, 3593, 4125, 4764
MunI CAATTG 1 cut(s) 5196
Mva1269I GAATGC 5 cut(s) 792, 1127, 2467, 5248, 5376
MvaI CCWGG 4 cut(s) 3122, 3265, 4125, 4764
MvnI CGCG 5 cut(s) 315, 323, 336, 374, 503
NciI CCSGG 1 cut(s) 3593
NcoI CCATGG 1 cut(s) 5531
NdeI CATATG 3 cut(s) 2770, 3724, 5398
NmeAIII GCCGAG 1 cut(s) 595
NmuCI GTSAC 8 cut(s) 375, 545, 661, 800, 1420, 1457, 4924, 5261
NsbI TGCGCA 1 cut(s) 459
NsiI ATGCAT 2 cut(s) 2232, 3340
OliI CACNNNNGTG 1 cut(s) 4301
PaeI GCATGC 2 cut(s) 1949, 2691
PagI TCATGA 1 cut(s) 2314
PasI CCCWGGG 1 cut(s) 4763
PauI GCGCGC 1 cut(s) 313
PceI AGGCCT 3 cut(s) 414, 3120, 3706
PciI ACATGT 6 cut(s) 673, 1214, 2293, 3056, 3133, 3667
PciSI GCTCTTC 5 cut(s) 303, 981, 2160, 2698, 3661
PcsI WCGNNNNNNNCGW 3 cut(s) 333, 389, 555
PctI GAATGC 5 cut(s) 792, 1127, 2467, 5248, 5376
PdmI GAANNNNTTC 3 cut(s) 1127, 3627, 5321
PflMI CCANNNNNTGG 2 cut(s) 2204, 5026
PmaCI CACGTG 1 cut(s) 328
PmlI CACGTG 1 cut(s) 328
Ppu21I YACGTR 3 cut(s) 328, 2570, 3245
PscI ACATGT 6 cut(s) 673, 1214, 2293, 3056, 3133, 3667
Psp124BI GAGCTC 1 cut(s) 3656
Psp1406I AACGTT 1 cut(s) 235
Psp6I CCWGG 4 cut(s) 3120, 3263, 4123, 4762
PspCI CACGTG 1 cut(s) 328
PspFI CCCAGC 2 cut(s) 3609, 5041
PspGI CCWGG 4 cut(s) 3120, 3263, 4123, 4762
PspPI GGNCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
PstNI CAGNNNCTG 4 cut(s) 2087, 4775, 5048, 5365
PsuI RGATCY 5 cut(s) 2971, 3571, 4279, 4409, 5224
PteI GCGCGC 1 cut(s) 313
PvuII CAGCTG 2 cut(s) 1223, 4598
RsaI GTAC 9 cut(s) 936, 2673, 3132, 3247, 3275, 3919, 4905, 4915, 4995
RsaNI GTAC 9 cut(s) 935, 2672, 3131, 3246, 3274, 3918, 4904, 4914, 4994
RseI CAYNNNNRTG 8 cut(s) 89, 678, 1950, 2597, 3098, 4185, 4301, 4960
SacI GAGCTC 1 cut(s) 3656
SacII CCGCGG 1 cut(s) 504
SalI GTCGAC 3 cut(s) 557, 1151, 5391
SapI GCTCTTC 5 cut(s) 303, 981, 2160, 2698, 3661
Sau96I GGNCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
ScaI AGTACT 1 cut(s) 3275
ScrFI CCNGG 5 cut(s) 3122, 3265, 3593, 4125, 4764
SduI GDGCHC 4 cut(s) 2431, 3037, 3656, 4805
SexAI ACCWGGT 1 cut(s) 4123
SfcI CTRYAG 7 cut(s) 772, 1980, 2853, 3342, 3948, 4071, 4248
Sfr303I CCGCGG 1 cut(s) 504
SgrBI CCGCGG 1 cut(s) 504
SinI GGWCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
SmiMI CAYNNNNRTG 8 cut(s) 89, 678, 1950, 2597, 3098, 4185, 4301, 4960
SmlI CTYRAG 7 cut(s) 266, 416, 519, 590, 1880, 3269, 3361
SmoI CTYRAG 7 cut(s) 266, 416, 519, 590, 1880, 3269, 3361
SnaBI TACGTA 1 cut(s) 3245
SpeI ACTAGT 1 cut(s) 4928
SphI GCATGC 2 cut(s) 1949, 2691
SseBI AGGCCT 3 cut(s) 414, 3120, 3706
SspI AATATT 2 cut(s) 1915, 4756
SspMI CTAG 7 cut(s) 1019, 1361, 1727, 1757, 2235, 3708, 4929
SstI GAGCTC 1 cut(s) 3656
StuI AGGCCT 3 cut(s) 414, 3120, 3706
StyD4I CCNGG 5 cut(s) 3120, 3263, 3591, 4123, 4762
TatI WGTACW 3 cut(s) 2671, 3130, 3273
TauI GCSGC 7 cut(s) 334, 506, 509, 512, 3425, 3733, 3748
TseFI GTSAC 8 cut(s) 375, 545, 661, 800, 1420, 1457, 4924, 5261
Tsp45I GTSAC 8 cut(s) 375, 545, 661, 800, 1420, 1457, 4924, 5261
TspGWI ACGGA 2 cut(s) 155, 3946
Van91I CCANNNNNTGG 2 cut(s) 2204, 5026
Vha464I CTTAAG 2 cut(s) 1880, 3361
VpaK11BI GGWCC 8 cut(s) 406, 2810, 3062, 3230, 4055, 4322, 4392, 5219
XagI CCTNNNNNAGG 1 cut(s) 945
XapI RAATTY 8 cut(s) 1329, 2444, 3210, 3640, 3923, 4375, 5030, 5091
XmiI GTMKAC 4 cut(s) 558, 1152, 3980, 5392
XmnI GAANNNNTTC 3 cut(s) 1127, 3627, 5321
XspI CTAG 7 cut(s) 1019, 1361, 1727, 1757, 2235, 3708, 4929
ZraI GACGTC 1 cut(s) 256
ZrmI AGTACT 1 cut(s) 3275
Zsp2I ATGCAT 2 cut(s) 2232, 3340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.