Rmu_ssc0000397.1_g000006

Indigoidine synthase A like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000397.1
OG0007924
Physical Location & Seq
Reverse (-)
32249 .. 35085
2837 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 588 bp
atggcgtcgtcgtcgtcgtcgtcttcagctctctcaagactgtccagtatcagcagacacttcaatccctcccacgcaaacaaggacggtgtggccttaatcaagatttctccagaggtttccgaagctttgtcaattgggcgtgccgtcgttgctcttgaatccaccattatttcccatgggatgccgtatcccaagaatttggagactgcaaaggaggttgaggcaattgtcagggaaaatggggctgttcctgccaccattgctatcttggatggcacaccttgcataggtctaactatagaagaactggagaggcttgccagattgggtccaagagctcagaagacagctcgaagagacattgcacatgttgtggcaaccagagggaacggtgcaactactgtttctgcaaccatgatttttgctcatatggttggcatcccattgtttgtaacgggaggaattggaggagtacatcaacatggcgagcatagtaagtcagttgtacattggcctatgaaatgtttctggcgtcctcttgaggccaatgagtttctggaatctgatgttggaagaggtggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 map00240
Pfam Domains
Protein Families
Indigoidine_A

Protein Analysis

195

Amino Acids

20.67

Weight (kDa)

7.91

Isoelectric Point (pI)

31.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Indigoidine_A PF04227 39 - 168 7.9e-56 Indigoidine synthase A like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 199
AcuI CTGAAG 1 cut(s) 9
AcyI GRCGYC 2 cut(s) 5, 535
AfaI GTAC 2 cut(s) 477, 510
AfiI CCNNNNNNNGG 1 cut(s) 290
AflIII ACRYGT 1 cut(s) 370
AgsI TTSAA 2 cut(s) 64, 161
AjuI GAANNNNNNNTTGG 2 cut(s) 555, 587
AluBI AGCT 4 cut(s) 29, 128, 341, 353
AluI AGCT 4 cut(s) 29, 128, 341, 353
Alw21I GWGCWC 1 cut(s) 343
Alw26I GTCTC 2 cut(s) 200, 354
AoxI GGCC 3 cut(s) 93, 515, 546
ApoI RAATTY 1 cut(s) 199
Asp700I GAANNNNTTC 1 cut(s) 527
AspS9I GGNCC 1 cut(s) 332
AvaII GGWCC 1 cut(s) 332
BanII GRGCYC 1 cut(s) 343
BbsI GAAGAC 2 cut(s) 15, 353
Bbv12I GWGCWC 1 cut(s) 343
BccI CCATC 1 cut(s) 269
BceAI ACGGC 2 cut(s) 131, 172
BciVI GTATCC 1 cut(s) 201
BcoDI GTCTC 2 cut(s) 200, 354
BfmI CTRYAG 1 cut(s) 300
BfuI GTATCC 1 cut(s) 201
Bme18I GGWCC 1 cut(s) 332
BmgT120I GGNCC 1 cut(s) 332
BmiI GGNNCC 1 cut(s) 333
BmsI GCATC 2 cut(s) 174, 450
BpiI GAAGAC 2 cut(s) 15, 353
BpmI CTGGAG 2 cut(s) 96, 332
BpuEI CTTGAG 2 cut(s) 19, 563
BsaHI GRCGYC 2 cut(s) 5, 535
BsaJI CCNNGG 1 cut(s) 178
Bsc4I CCNNNNNNNGG 1 cut(s) 290
Bse1I ACTGG 2 cut(s) 45, 315
Bse3DI GCAATG 2 cut(s) 261, 363
BseDI CCNNGG 1 cut(s) 178
BseGI GGATG 3 cut(s) 189, 280, 441
BseLI CCNNNNNNNGG 1 cut(s) 290
BseMI GCAATG 2 cut(s) 261, 363
BseMII CTCAG 1 cut(s) 356
BseNI ACTGG 2 cut(s) 45, 315
BseRI GAGGAG 1 cut(s) 486
BshFI GGCC 3 cut(s) 95, 517, 548
BsiHKAI GWGCWC 1 cut(s) 343
BslI CCNNNNNNNGG 1 cut(s) 290
BsmAI GTCTC 2 cut(s) 200, 354
BsnI GGCC 3 cut(s) 95, 517, 548
Bsp1286I GDGCHC 1 cut(s) 343
Bsp1407I TGTACA 1 cut(s) 508
Bsp19I CCATGG 1 cut(s) 178
BspANI GGCC 3 cut(s) 95, 517, 548
BspCNI CTCAG 1 cut(s) 355
BspLI GGNNCC 1 cut(s) 333
BsrDI GCAATG 2 cut(s) 261, 363
BsrGI TGTACA 1 cut(s) 508
BsrI ACTGG 2 cut(s) 45, 315
BssECI CCNNGG 1 cut(s) 178
BssNI GRCGYC 2 cut(s) 5, 535
BssT1I CCWWGG 1 cut(s) 178
Bst4CI ACNGT 4 cut(s) 42, 89, 395, 406
Bst6I CTCTTC 2 cut(s) 352, 571
BstACI GRCGYC 2 cut(s) 5, 535
BstAPI GCANNNNNTGC 1 cut(s) 285
BstAUI TGTACA 1 cut(s) 508
BstC8I GCNNGC 3 cut(s) 144, 321, 491
BstDEI CTNAG 1 cut(s) 342
BstDSI CCRYGG 1 cut(s) 178
BstENI CCTNNNNNAGG 1 cut(s) 288
BstF5I GGATG 3 cut(s) 189, 280, 441
BstMAI GTCTC 2 cut(s) 200, 354
BstMWI GCNNNNNNNGC 4 cut(s) 152, 254, 263, 285
BstNSI RCATGY 1 cut(s) 374
BstSFI CTRYAG 1 cut(s) 300
BstV2I GAAGAC 2 cut(s) 15, 353
BstXI CCANNNNNNTGG 1 cut(s) 202
BsuI GTATCC 1 cut(s) 201
BsuRI GGCC 3 cut(s) 95, 517, 548
BtgI CCRYGG 1 cut(s) 178
BtsCI GGATG 3 cut(s) 189, 280, 441
Cac8I GCNNGC 3 cut(s) 144, 321, 491
Cfr13I GGNCC 1 cut(s) 332
CseI GACGC 1 cut(s) 524
Csp6I GTAC 2 cut(s) 476, 509
CviAII CATG 4 cut(s) 179, 371, 418, 485
CviJI RGCY 9 cut(s) 29, 95, 128, 248, 319, 341, 353, 517, 548
CviKI_1 RGCY 9 cut(s) 29, 95, 128, 248, 319, 341, 353, 517, 548
CviQI GTAC 2 cut(s) 476, 509
DdeI CTNAG 1 cut(s) 342
Eam1104I CTCTTC 2 cut(s) 352, 571
EarI CTCTTC 2 cut(s) 352, 571
Ecl136II GAGCTC 1 cut(s) 341
Eco130I CCWWGG 1 cut(s) 178
Eco24I GRGCYC 1 cut(s) 343
Eco47I GGWCC 1 cut(s) 332
Eco53kI GAGCTC 1 cut(s) 341
Eco57I CTGAAG 1 cut(s) 9
EcoICRI GAGCTC 1 cut(s) 341
EcoNI CCTNNNNNAGG 1 cut(s) 288
EcoT14I CCWWGG 1 cut(s) 178
EcoT38I GRGCYC 1 cut(s) 343
ErhI CCWWGG 1 cut(s) 178
FaeI CATG 4 cut(s) 182, 374, 421, 488
FatI CATG 4 cut(s) 178, 370, 417, 484
FauNDI CATATG 1 cut(s) 432
FokI GGATG 3 cut(s) 196, 287, 428
FriOI GRGCYC 1 cut(s) 343
GsuI CTGGAG 2 cut(s) 96, 332
HaeIII GGCC 3 cut(s) 95, 517, 548
HgaI GACGC 1 cut(s) 524
Hin1I GRCGYC 2 cut(s) 5, 535
Hin1II CATG 4 cut(s) 182, 374, 421, 488
HindIII AAGCTT 1 cut(s) 126
HinfI GANTC 2 cut(s) 161, 563
Hpy188I TCNGA 3 cut(s) 124, 345, 568
Hpy188III TCNNGA 6 cut(s) 36, 103, 113, 158, 542, 560
Hpy99I CGWCG 6 cut(s) 10, 13, 16, 19, 22, 152
HpyCH4III ACNGT 4 cut(s) 42, 89, 395, 406
HpyCH4V TGCA 5 cut(s) 212, 288, 368, 398, 413
HpyF10VI GCNNNNNNNGC 4 cut(s) 152, 254, 263, 285
HpyF3I CTNAG 1 cut(s) 342
Hsp92I GRCGYC 2 cut(s) 5, 535
Hsp92II CATG 4 cut(s) 182, 374, 421, 488
LpnPI CCDG 9 cut(s) 58, 126, 220, 267, 296, 337, 397, 517, 545
LweI GCATC 2 cut(s) 174, 450
MaeIII GTNAC 1 cut(s) 454
MboII GAAGA 5 cut(s) 15, 317, 358, 369, 588
MfeI CAATTG 2 cut(s) 135, 228
MhlI GDGCHC 1 cut(s) 343
MluCI AATT 4 cut(s) 135, 199, 228, 465
MmeI TCCRAC 1 cut(s) 553
MroXI GAANNNNTTC 1 cut(s) 527
MseI TTAA 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 483
MunI CAATTG 2 cut(s) 135, 228
MwoI GCNNNNNNNGC 4 cut(s) 152, 254, 263, 285
NcoI CCATGG 1 cut(s) 178
NdeI CATATG 1 cut(s) 432
NlaIII CATG 4 cut(s) 182, 374, 421, 488
NlaIV GGNNCC 1 cut(s) 333
NspI RCATGY 1 cut(s) 374
PciI ACATGT 1 cut(s) 370
PcsI WCGNNNNNNNCGW 2 cut(s) 14, 17
PdmI GAANNNNTTC 1 cut(s) 527
PfeI GAWTC 2 cut(s) 161, 563
PscI ACATGT 1 cut(s) 370
Psp124BI GAGCTC 1 cut(s) 343
PspN4I GGNNCC 1 cut(s) 333
PspPI GGNCC 1 cut(s) 332
RsaI GTAC 2 cut(s) 477, 510
RsaNI GTAC 2 cut(s) 476, 509
RseI CAYNNNNRTG 1 cut(s) 483
SacI GAGCTC 1 cut(s) 343
SaqAI TTAA 1 cut(s) 98
Sau96I GGNCC 1 cut(s) 332
SduI GDGCHC 1 cut(s) 343
SetI ASST 9 cut(s) 31, 120, 130, 222, 286, 295, 343, 355, 583
SfaNI GCATC 2 cut(s) 174, 450
SfcI CTRYAG 1 cut(s) 300
SinI GGWCC 1 cut(s) 332
SmiMI CAYNNNNRTG 1 cut(s) 483
SmlI CTYRAG 2 cut(s) 34, 542
SmoI CTYRAG 2 cut(s) 34, 542
Sse9I AATT 4 cut(s) 135, 199, 228, 465
SstI GAGCTC 1 cut(s) 343
StyI CCWWGG 1 cut(s) 178
TaaI ACNGT 4 cut(s) 42, 89, 395, 406
TaqI TCGA 1 cut(s) 355
TasI AATT 4 cut(s) 135, 199, 228, 465
TatI WGTACW 2 cut(s) 475, 508
TfiI GAWTC 2 cut(s) 161, 563
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TspDTI ATGAA 1 cut(s) 536
VpaK11BI GGWCC 1 cut(s) 332
XagI CCTNNNNNAGG 1 cut(s) 288
XapI RAATTY 1 cut(s) 199
XceI RCATGY 1 cut(s) 374
XcmI CCANNNNNNNNNTGG 2 cut(s) 268, 556
XmnI GAANNNNTTC 1 cut(s) 527
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.