Rroxscaffold_1G00060160

Protein of unknown function (DUF1279)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
82306208 .. 82309463
3256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00060160.1

Sequence Viewer

Length: 222 bp
ATGGCTGTGGTTGAGGAGAGGAAGAGGATTCGGACGGCGGAACTCGCAACCACCAGCGGTGGTGCTTTGGCATTGGCTTTTCTCTACAACAAGGCTCTGTTTCCGATTCATCTTTTGAAGACATTAGAAGCGAGGGCATCAGTAACTTCTAGGCTCAAAGAGCTCAAATCCCAGATGAATGAGACGAGGGGAAGAAGAAGCACCACCGCTGACCAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.13

Weight (kDa)

10.57

Isoelectric Point (pI)

40.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 38, 57, 207
AgsI TTSAA 1 cut(s) 118
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
Alw21I GWGCWC 1 cut(s) 165
Alw26I GTCTC 1 cut(s) 176
BanII GRGCYC 1 cut(s) 165
BbsI GAAGAC 1 cut(s) 125
Bbv12I GWGCWC 1 cut(s) 165
BceAI ACGGC 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 176
BfaI CTAG 1 cut(s) 150
BmsI GCATC 1 cut(s) 146
BpiI GAAGAC 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 29
BsiHKAI GWGCWC 1 cut(s) 165
BsmAI GTCTC 1 cut(s) 176
BsmBI CGTCTC 1 cut(s) 176
Bsp1286I GDGCHC 1 cut(s) 165
BspACI CCGC 3 cut(s) 38, 57, 207
Bst6I CTCTTC 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 176
BstMWI GCNNNNNNNGC 2 cut(s) 44, 160
BstV2I GAAGAC 1 cut(s) 125
CviJI RGCY 5 cut(s) 5, 77, 95, 154, 163
CviKI_1 RGCY 5 cut(s) 5, 77, 95, 154, 163
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
EciI GGCGGA 1 cut(s) 53
Ecl136II GAGCTC 1 cut(s) 163
Eco24I GRGCYC 1 cut(s) 165
Eco53kI GAGCTC 1 cut(s) 163
EcoICRI GAGCTC 1 cut(s) 163
EcoT38I GRGCYC 1 cut(s) 165
Esp3I CGTCTC 1 cut(s) 176
FriOI GRGCYC 1 cut(s) 165
FspBI CTAG 1 cut(s) 150
HinfI GANTC 2 cut(s) 28, 106
Hpy188I TCNGA 2 cut(s) 33, 105
HpyF10VI GCNNNNNNNGC 2 cut(s) 44, 160
LpnPI CCDG 2 cut(s) 67, 185
LweI GCATC 1 cut(s) 146
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 142
MboII GAAGA 4 cut(s) 34, 130, 204, 207
MhlI GDGCHC 1 cut(s) 165
MluCI AATT 1 cut(s) 217
MnlI CCTC 5 cut(s) 7, 12, 18, 126, 180
MseI TTAA 1 cut(s) 220
MspA1I CMGCKG 2 cut(s) 57, 209
MwoI GCNNNNNNNGC 2 cut(s) 44, 160
PfeI GAWTC 2 cut(s) 28, 106
Psp124BI GAGCTC 1 cut(s) 165
SacI GAGCTC 1 cut(s) 165
SaqAI TTAA 1 cut(s) 220
SduI GDGCHC 1 cut(s) 165
SetI ASST 1 cut(s) 165
SfaNI GCATC 1 cut(s) 146
SgeI CNNG 7 cut(s) 56, 66, 103, 144, 162, 184, 198
Sse9I AATT 1 cut(s) 217
SsiI CCGC 3 cut(s) 38, 57, 207
SspMI CTAG 1 cut(s) 150
SstI GAGCTC 1 cut(s) 165
TasI AATT 1 cut(s) 217
TfiI GAWTC 2 cut(s) 28, 106
Tru1I TTAA 1 cut(s) 220
Tru9I TTAA 1 cut(s) 220
TspDTI ATGAA 2 cut(s) 98, 191
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.