Rroxscaffold_1G00068520

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0006665
Physical Location & Seq
Reverse (-)
89707888 .. 89713467
5580 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00068520.1

Sequence Viewer

Length: 399 bp
ATGGCGGAGCAGTCGTGGGCAGAGCCATCGGACAGGGCGGAGCCTTCGTGGGCAGAGCCATCGGATAGGGCGGAGCCGTCGTGGGCAGGGGCATCGTCCGACCGGCCAGAGCCGTCTTCGGCAGAGGCGACACAGCGAAGGCACAGCCACCGCAGAGGGTTGGCCTTCAACACTTACTTGTTCTGCATCTTTTTGGATTTTCAACAGACAAAAAGATCAGTTAAGAGTACTGGTCTGATTTCTAAGAAAGAGAACCCGTTGGGCTTCAAAGAGATATACAAATTCCACCTCGGACCAGGTTACAAGAATCTAACTCTGCCAATCGATAAGGACCTGTTGATCCATATTAAAGATATGCTTTTGATCTTGTTTTTGAAGGAGTTTGTTGCATGTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

15.1

Weight (kDa)

7.8

Isoelectric Point (pI)

52.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 5, 38, 71, 151
AclWI GGATC 1 cut(s) 334
AcoI YGGCCR 1 cut(s) 104
AcsI RAATTY 1 cut(s) 281
AfaI GTAC 1 cut(s) 229
AgsI TTSAA 4 cut(s) 169, 203, 268, 376
AjnI CCWGG 1 cut(s) 295
AlwI GGATC 1 cut(s) 334
AoxI GGCC 2 cut(s) 104, 162
ApoI RAATTY 1 cut(s) 281
AspS9I GGNCC 2 cut(s) 293, 331
AvaII GGWCC 2 cut(s) 293, 331
BbsI GAAGAC 1 cut(s) 108
BccI CCATC 2 cut(s) 34, 67
BceAI ACGGC 2 cut(s) 61, 97
BcgI CGANNNNNNTGC 6 cut(s) 9, 42, 43, 75, 76, 109
BciT130I CCWGG 1 cut(s) 297
BmcAI AGTACT 1 cut(s) 229
Bme1390I CCNGG 1 cut(s) 297
Bme18I GGWCC 2 cut(s) 293, 331
BmgT120I GGNCC 2 cut(s) 293, 331
BmiI GGNNCC 2 cut(s) 42, 75
BmrFI CCNGG 1 cut(s) 297
BmsI GCATC 2 cut(s) 101, 195
BpiI GAAGAC 1 cut(s) 108
Bsa29I ATCGAT 1 cut(s) 324
BsaJI CCNNGG 1 cut(s) 289
BsaXI ACNNNNNCTCC 5 cut(s) 29, 32, 62, 65, 95
Bse118I RCCGGY 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 235
BseBI CCWGG 1 cut(s) 297
BseCI ATCGAT 1 cut(s) 324
BseDI CCNNGG 1 cut(s) 289
BseNI ACTGG 1 cut(s) 235
Bsh1285I CGRYCG 1 cut(s) 103
BshFI GGCC 2 cut(s) 106, 164
BshVI ATCGAT 1 cut(s) 324
BsiEI CGRYCG 1 cut(s) 103
BsiSI CCGG 1 cut(s) 103
BsnI GGCC 2 cut(s) 106, 164
Bsp143I GATC 3 cut(s) 215, 339, 363
BspACI CCGC 4 cut(s) 5, 38, 71, 151
BspANI GGCC 2 cut(s) 106, 164
BspDI ATCGAT 1 cut(s) 324
BspLI GGNNCC 2 cut(s) 42, 75
BspPI GGATC 1 cut(s) 334
BsrFI RCCGGY 1 cut(s) 102
BsrI ACTGG 1 cut(s) 235
BssAI RCCGGY 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 289
BssMI GATC 3 cut(s) 215, 339, 363
Bst2UI CCWGG 1 cut(s) 297
BstDEI CTNAG 1 cut(s) 243
BstKTI GATC 3 cut(s) 218, 342, 366
BstMBI GATC 3 cut(s) 215, 339, 363
BstMCI CGRYCG 1 cut(s) 103
BstNI CCWGG 1 cut(s) 297
BstNSI RCATGY 1 cut(s) 393
BstSCI CCNGG 1 cut(s) 295
BstV2I GAAGAC 1 cut(s) 108
Bsu15I ATCGAT 1 cut(s) 324
BsuRI GGCC 2 cut(s) 106, 164
BsuTUI ATCGAT 1 cut(s) 324
Cfr10I RCCGGY 1 cut(s) 102
Cfr13I GGNCC 2 cut(s) 293, 331
ClaI ATCGAT 1 cut(s) 324
CsiI ACCWGGT 1 cut(s) 295
Csp6I GTAC 1 cut(s) 228
CviAII CATG 1 cut(s) 390
CviJI RGCY 9 cut(s) 25, 43, 58, 76, 106, 112, 147, 164, 264
CviKI_1 RGCY 9 cut(s) 25, 43, 58, 76, 106, 112, 147, 164, 264
CviQI GTAC 1 cut(s) 228
DdeI CTNAG 1 cut(s) 243
DpnI GATC 3 cut(s) 217, 341, 365
DpnII GATC 3 cut(s) 215, 339, 363
EaeI YGGCCR 1 cut(s) 104
EciI GGCGGA 3 cut(s) 20, 53, 86
Eco47I GGWCC 2 cut(s) 293, 331
EcoO109I RGGNCCY 1 cut(s) 331
EcoRII CCWGG 1 cut(s) 295
FaeI CATG 1 cut(s) 393
FaiI YATR 4 cut(s) 277, 345, 356, 391
FalI AAGNNNNNCTT 2 cut(s) 342, 374
FatI CATG 1 cut(s) 389
HaeIII GGCC 2 cut(s) 106, 164
HapII CCGG 1 cut(s) 103
Hin1II CATG 1 cut(s) 393
HinfI GANTC 1 cut(s) 307
HpaII CCGG 1 cut(s) 103
Hpy188I TCNGA 5 cut(s) 31, 64, 100, 237, 293
Hpy99I CGWCG 1 cut(s) 82
HpyAV CCTTC 4 cut(s) 54, 132, 175, 370
HpyCH4V TGCA 2 cut(s) 186, 389
HpyF3I CTNAG 1 cut(s) 243
Hsp92II CATG 1 cut(s) 393
Kzo9I GATC 3 cut(s) 215, 339, 363
LmnI GCTCC 3 cut(s) 7, 40, 73
LpnPI CCDG 8 cut(s) 19, 72, 116, 120, 216, 282, 309, 347
LweI GCATC 2 cut(s) 101, 195
MabI ACCWGGT 1 cut(s) 295
MaeIII GTNAC 1 cut(s) 299
MalI GATC 3 cut(s) 217, 341, 365
MboI GATC 3 cut(s) 215, 339, 363
MboII GAAGA 1 cut(s) 108
MluCI AATT 1 cut(s) 281
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 3 cut(s) 118, 149, 299
MseI TTAA 2 cut(s) 222, 348
MspI CCGG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 297
MvaI CCWGG 1 cut(s) 297
NdeII GATC 3 cut(s) 215, 339, 363
NlaIII CATG 1 cut(s) 393
NlaIV GGNNCC 2 cut(s) 42, 75
NspI RCATGY 1 cut(s) 393
PcsI WCGNNNNNNNCGW 1 cut(s) 125
PfeI GAWTC 1 cut(s) 307
PpuMI RGGWCCY 1 cut(s) 331
Psp5II RGGWCCY 1 cut(s) 331
Psp6I CCWGG 1 cut(s) 295
PspGI CCWGG 1 cut(s) 295
PspN4I GGNNCC 2 cut(s) 42, 75
PspPI GGNCC 2 cut(s) 293, 331
PspPPI RGGWCCY 1 cut(s) 331
RsaI GTAC 1 cut(s) 229
RsaNI GTAC 1 cut(s) 228
SaqAI TTAA 2 cut(s) 222, 348
Sau3AI GATC 3 cut(s) 215, 339, 363
Sau96I GGNCC 2 cut(s) 293, 331
ScaI AGTACT 1 cut(s) 229
ScrFI CCNGG 1 cut(s) 297
SetI ASST 3 cut(s) 291, 301, 336
SexAI ACCWGGT 1 cut(s) 295
SfaNI GCATC 2 cut(s) 101, 195
SinI GGWCC 2 cut(s) 293, 331
Sse9I AATT 1 cut(s) 281
SsiI CCGC 4 cut(s) 5, 38, 71, 151
StyD4I CCNGG 1 cut(s) 295
TaqI TCGA 1 cut(s) 324
TasI AATT 1 cut(s) 281
TatI WGTACW 1 cut(s) 227
TfiI GAWTC 1 cut(s) 307
Tru1I TTAA 2 cut(s) 222, 348
Tru9I TTAA 2 cut(s) 222, 348
VpaK11BI GGWCC 2 cut(s) 293, 331
XapI RAATTY 1 cut(s) 281
XceI RCATGY 1 cut(s) 393
ZrmI AGTACT 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.