Rroxscaffold_2G00121520

Belongs to the glycosyltransferase 1 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
54146425 .. 54152182
5758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00121520.1

Sequence Viewer

Length: 192 bp
ATGTTTCAATTACTAAATGCTACACCGATTGGGAGAAATGGTGGAAGACTTTTCCCGTATCCGCATTATTCGTCACACATTGACTACCGATGGGATTGTGAAGGACTAAAGAAAACCATGTGGAAGCTCTTAAATGCCCCCGATGTCGTCTCTCGTTTGTCGACCTCGACTTCAACAGCCCGCTCATCTTAG

Protein Analysis

63

Amino Acids

7.17

Weight (kDa)

9.74

Isoelectric Point (pI)

52.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 183
AccI GTMKAC 1 cut(s) 161
AciI CCGC 2 cut(s) 62, 181
AgsI TTSAA 2 cut(s) 8, 174
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw26I GTCTC 1 cut(s) 154
BbsI GAAGAC 1 cut(s) 52
BccI CCATC 1 cut(s) 84
BciVI GTATCC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 154
BfuI GTATCC 1 cut(s) 69
BpiI GAAGAC 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
BsmAI GTCTC 1 cut(s) 154
BsmBI CGTCTC 1 cut(s) 154
BspACI CCGC 2 cut(s) 62, 181
BsrBI CCGCTC 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 189
BstMAI GTCTC 1 cut(s) 154
BstV2I GAAGAC 1 cut(s) 52
BsuI GTATCC 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 181
CviAII CATG 1 cut(s) 118
CviJI RGCY 2 cut(s) 127, 179
CviKI_1 RGCY 2 cut(s) 127, 179
DdeI CTNAG 1 cut(s) 189
Esp3I CGTCTC 1 cut(s) 154
FaeI CATG 1 cut(s) 121
FaiI YATR 1 cut(s) 119
FatI CATG 1 cut(s) 117
FauI CCCGC 1 cut(s) 188
FblI GTMKAC 1 cut(s) 161
Hin1II CATG 1 cut(s) 121
HincII GTYRAC 1 cut(s) 162
HindII GTYRAC 1 cut(s) 162
Hpy166II GTNNAC 1 cut(s) 162
Hpy8I GTNNAC 1 cut(s) 162
HpyAV CCTTC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 189
Hsp92II CATG 1 cut(s) 121
MaeIII GTNAC 1 cut(s) 72
MbiI CCGCTC 1 cut(s) 183
MboII GAAGA 1 cut(s) 57
MluCI AATT 1 cut(s) 8
MnlI CCTC 1 cut(s) 175
MseI TTAA 1 cut(s) 131
NlaIII CATG 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 72
SalI GTCGAC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 131
SetI ASST 2 cut(s) 129, 167
SgeI CNNG 5 cut(s) 67, 130, 152, 165, 178
Sse9I AATT 1 cut(s) 8
SsiI CCGC 2 cut(s) 62, 181
TaqI TCGA 2 cut(s) 161, 167
TasI AATT 1 cut(s) 8
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TseFI GTSAC 1 cut(s) 72
Tsp45I GTSAC 1 cut(s) 72
XmiI GTMKAC 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.