Rh7AG324900

Belongs to the glycosyltransferase 1 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
36911606 .. 36911842
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG324900.1

Sequence Viewer

Length: 237 bp
ATGATTCAAATTGTGCAAGAAATATTTAAGGCTGTAAGACTAGATTCTCAAAGTGCAAGATTTACAGGGTTTGCTCTGCTAACAGCTATGCCAGCATCAGATACAGTAGAGTTTCTGGCATCAGGGAGGGTACAGGCAAATGAGTTTGATGTGTTGGTTTATAGCAGTGGAAGTGAGGTTTACTACCCTGGTACTTATACAGAAGAAGATGGAAGACTTTCCCCAGATCCAGATTAG

Protein Analysis

78

Amino Acids

8.6

Weight (kDa)

4.2

Isoelectric Point (pI)

45.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 221
AfaI GTAC 2 cut(s) 132, 193
AgsI TTSAA 1 cut(s) 8
AjnI CCWGG 1 cut(s) 187
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
AlwI GGATC 1 cut(s) 221
Asp700I GAANNNNTTC 1 cut(s) 217
BbsI GAAGAC 1 cut(s) 220
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 189
BfaI CTAG 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BmsI GCATC 2 cut(s) 104, 128
BpiI GAAGAC 1 cut(s) 220
BsaJI CCNNGG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 189
BseDI CCNNGG 1 cut(s) 187
Bsp143I GATC 1 cut(s) 226
BspPI GGATC 1 cut(s) 221
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 1 cut(s) 226
Bst2UI CCWGG 1 cut(s) 189
Bst4CI ACNGT 1 cut(s) 106
BstC8I GCNNGC 1 cut(s) 93
BstKTI GATC 1 cut(s) 229
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BstV2I GAAGAC 1 cut(s) 220
BstX2I RGATCY 1 cut(s) 226
BstYI RGATCY 1 cut(s) 226
BtsI GCAGTG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 172
Cac8I GCNNGC 1 cut(s) 93
Csp6I GTAC 2 cut(s) 131, 192
CviJI RGCY 2 cut(s) 32, 86
CviKI_1 RGCY 2 cut(s) 32, 86
CviQI GTAC 2 cut(s) 131, 192
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
EcoRII CCWGG 1 cut(s) 187
FaiI YATR 3 cut(s) 89, 162, 198
FspBI CTAG 1 cut(s) 41
HinfI GANTC 2 cut(s) 4, 44
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 16, 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Kzo9I GATC 1 cut(s) 226
LpnPI CCDG 7 cut(s) 51, 101, 105, 108, 119, 174, 201
LweI GCATC 2 cut(s) 104, 128
MaeI CTAG 1 cut(s) 41
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 3 cut(s) 215, 218, 225
MflI RGATCY 1 cut(s) 226
MluCI AATT 1 cut(s) 9
MnlI CCTC 2 cut(s) 120, 169
MroXI GAANNNNTTC 1 cut(s) 217
MseI TTAA 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 1 cut(s) 226
PdmI GAANNNNTTC 1 cut(s) 217
PfeI GAWTC 2 cut(s) 4, 44
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
PsuI RGATCY 1 cut(s) 226
RsaI GTAC 2 cut(s) 132, 193
RsaNI GTAC 2 cut(s) 131, 192
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 226
ScrFI CCNGG 1 cut(s) 189
SetI ASST 2 cut(s) 88, 180
SfaNI GCATC 2 cut(s) 104, 128
Sse9I AATT 1 cut(s) 9
SspI AATATT 1 cut(s) 24
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 1 cut(s) 187
TaaI ACNGT 1 cut(s) 106
TasI AATT 1 cut(s) 9
TfiI GAWTC 2 cut(s) 4, 44
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TscAI CASTG 1 cut(s) 172
TspRI CASTG 1 cut(s) 172
XmnI GAANNNNTTC 1 cut(s) 217
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.