Rroxscaffold_3G00252940
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
46999682 .. 47001587
1906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00252940.1

Sequence Viewer

Length: 180 bp
ATGACTTTCCACAATGTTACCTACTCTGTTCACAAGCCAAAGGAGATGAAATCACAAGGTATACCAGAATCGAAGTTGCAACTCTTGTCGAATGTGAGCGGAGTATTCTCACCAGGTAAGTTTTTCGACAAAACATGCAGTATAATGACTATGGAACAAATGAGGAAAGACGATGACTAA

Protein Analysis

59

Amino Acids

6.76

Weight (kDa)

7.9

Isoelectric Point (pI)

36.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 99
AccI GTMKAC 1 cut(s) 61
AciI CCGC 1 cut(s) 99
AjnI CCWGG 1 cut(s) 112
AsuHPI GGTGA 1 cut(s) 102
BciT130I CCWGG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 114
BseBI CCWGG 1 cut(s) 114
BspACI CCGC 1 cut(s) 99
BsrBI CCGCTC 1 cut(s) 99
BssNAI GTATAC 1 cut(s) 62
Bst1107I GTATAC 1 cut(s) 62
Bst2UI CCWGG 1 cut(s) 114
BstNI CCWGG 1 cut(s) 114
BstNSI RCATGY 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 112
BstZ17I GTATAC 1 cut(s) 62
CsiI ACCWGGT 1 cut(s) 112
CviAII CATG 1 cut(s) 135
CviJI RGCY 1 cut(s) 37
CviKI_1 RGCY 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 112
FaeI CATG 1 cut(s) 138
FaiI YATR 4 cut(s) 62, 136, 143, 152
FatI CATG 1 cut(s) 134
FblI GTMKAC 1 cut(s) 61
Hin1II CATG 1 cut(s) 138
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 102
Hpy166II GTNNAC 2 cut(s) 31, 62
Hpy8I GTNNAC 2 cut(s) 31, 62
HpyCH4V TGCA 2 cut(s) 79, 138
Hsp92II CATG 1 cut(s) 138
LpnPI CCDG 3 cut(s) 78, 99, 126
MabI ACCWGGT 1 cut(s) 112
MaeIII GTNAC 1 cut(s) 16
MbiI CCGCTC 1 cut(s) 99
MnlI CCTC 1 cut(s) 156
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NlaIII CATG 1 cut(s) 138
NspI RCATGY 1 cut(s) 138
PfeI GAWTC 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 114
SetI ASST 3 cut(s) 23, 61, 118
SexAI ACCWGGT 1 cut(s) 112
SgeI CNNG 7 cut(s) 46, 68, 77, 97, 125, 126, 147
SsiI CCGC 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 112
TaqI TCGA 3 cut(s) 71, 89, 126
TfiI GAWTC 1 cut(s) 68
TspDTI ATGAA 1 cut(s) 62
XceI RCATGY 1 cut(s) 138
XmiI GTMKAC 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.