Rroxscaffold_5G00381910
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
61721149 .. 61721689
541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00381910.1

Sequence Viewer

Length: 156 bp
ATGAAGTCACAAGGTATACCAGAATCGAAGTTGCAACTCTTGTCGAAGGTATTTGTCGAAGAAGTTATGAAACTAGTAGAGCTTGATACTCTAAGGCATGCTTTGGTTGGTGTGCCGGGCGGTTCAAACTTATCAACGAGCAAAGAAAACGCTTAA

Protein Analysis

51

Amino Acids

5.51

Weight (kDa)

6.54

Isoelectric Point (pI)

35.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 16
AciI CCGC 1 cut(s) 120
AgsI TTSAA 1 cut(s) 126
AhlI ACTAGT 1 cut(s) 73
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
AsuC2I CCSGG 1 cut(s) 117
BcnI CCSGG 1 cut(s) 117
BcuI ACTAGT 1 cut(s) 73
BfaI CTAG 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 117
BmrFI CCNGG 1 cut(s) 117
BpuMI CCSGG 1 cut(s) 117
BsiSI CCGG 1 cut(s) 116
BspACI CCGC 1 cut(s) 120
BssNAI GTATAC 1 cut(s) 17
Bst1107I GTATAC 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 115
BstZ17I GTATAC 1 cut(s) 17
Cac8I GCNNGC 1 cut(s) 99
CviAII CATG 1 cut(s) 98
CviJI RGCY 1 cut(s) 82
CviKI_1 RGCY 1 cut(s) 82
DdeI CTNAG 1 cut(s) 92
FaeI CATG 1 cut(s) 101
FaiI YATR 3 cut(s) 17, 68, 99
FalI AAGNNNNNCTT 2 cut(s) 85, 117
FatI CATG 1 cut(s) 97
FblI GTMKAC 1 cut(s) 16
FspBI CTAG 1 cut(s) 74
FspEI CC 9 cut(s) 32, 33, 79, 89, 93, 101, 102, 105, 129
HapII CCGG 1 cut(s) 116
Hin1II CATG 1 cut(s) 101
HinfI GANTC 1 cut(s) 23
HpaII CCGG 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 17
Hpy8I GTNNAC 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 92
Hsp92II CATG 1 cut(s) 101
LpnPI CCDG 2 cut(s) 33, 129
MaeI CTAG 1 cut(s) 74
MaeIII GTNAC 1 cut(s) 6
MboII GAAGA 1 cut(s) 71
MseI TTAA 1 cut(s) 154
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 1 cut(s) 117
NciI CCSGG 1 cut(s) 117
NlaIII CATG 1 cut(s) 101
NmuCI GTSAC 1 cut(s) 6
NspI RCATGY 1 cut(s) 101
PaeI GCATGC 1 cut(s) 101
PfeI GAWTC 1 cut(s) 23
SaqAI TTAA 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 117
SetI ASST 3 cut(s) 16, 51, 84
SgeI CNNG 9 cut(s) 23, 32, 52, 86, 95, 110, 128, 129, 150
SpeI ACTAGT 1 cut(s) 73
SphI GCATGC 1 cut(s) 101
SsiI CCGC 1 cut(s) 120
SspMI CTAG 1 cut(s) 74
StyD4I CCNGG 1 cut(s) 115
TaqI TCGA 3 cut(s) 26, 44, 57
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 1 cut(s) 154
Tru9I TTAA 1 cut(s) 154
TseFI GTSAC 1 cut(s) 6
Tsp45I GTSAC 1 cut(s) 6
TspDTI ATGAA 2 cut(s) 17, 83
XceI RCATGY 1 cut(s) 101
XmiI GTMKAC 1 cut(s) 16
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.