Rroxscaffold_3G00274950

Domain of unknown function (DUF4539)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0006732
Physical Location & Seq
Forward (+)
66553438 .. 66558636
5199 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00274950.1

Sequence Viewer

Length: 237 bp
ATGGAGGATATGGCTGATGCTAAGGACCAAGTTAATCATCAGGATCCTACAGGTACAATTGGAGCCACCATCCACAACAAAGCCCTCTCCGAAGGAGAGTTTGGGAAGAGCATTTCTGTGGGTGCAGTTTTGGTTCTGCAGAAGGTTGGGTTTTCCGATGTCTCATTTACAGTCATTTCCAAGGACAGTAGTGGACCTCTTGCCACACAAGATTTTCCAATTTCATCAGTTAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4539

Protein Analysis

78

Amino Acids

8.15

Weight (kDa)

4.78

Isoelectric Point (pI)

29.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HROB PF15072 10 - 52 8.6e-10 Homologous recombination OB-fold protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 38, 51
AfaI GTAC 1 cut(s) 55
AjuI GAANNNNNNNTTGG 2 cut(s) 84, 116
Alw26I GTCTC 1 cut(s) 166
AlwI GGATC 2 cut(s) 38, 51
AspS9I GGNCC 2 cut(s) 25, 194
AvaII GGWCC 2 cut(s) 25, 194
BamHI GGATCC 1 cut(s) 43
BccI CCATC 1 cut(s) 77
BcoDI GTCTC 1 cut(s) 166
BfmI CTRYAG 2 cut(s) 48, 137
Bme18I GGWCC 2 cut(s) 25, 194
BmgT120I GGNCC 2 cut(s) 25, 194
BmiI GGNNCC 2 cut(s) 45, 64
BmsI GCATC 1 cut(s) 7
Bpu10I CCTNAGC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 180
BseGI GGATG 1 cut(s) 69
BsgI GTGCAG 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 43
BspLI GGNNCC 2 cut(s) 45, 64
BspMAI CTGCAG 1 cut(s) 141
BspPI GGATC 2 cut(s) 38, 51
BspQI GCTCTTC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 180
Bst4CI ACNGT 2 cut(s) 172, 188
Bst6I CTCTTC 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 69
BstKTI GATC 1 cut(s) 46
BstMAI GTCTC 1 cut(s) 166
BstMBI GATC 1 cut(s) 43
BstSFI CTRYAG 2 cut(s) 48, 137
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BtsCI GGATG 1 cut(s) 69
Cfr13I GGNCC 2 cut(s) 25, 194
Csp6I GTAC 1 cut(s) 54
CviJI RGCY 3 cut(s) 14, 65, 83
CviKI_1 RGCY 3 cut(s) 14, 65, 83
CviQI GTAC 1 cut(s) 54
DdeI CTNAG 1 cut(s) 21
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco130I CCWWGG 1 cut(s) 180
Eco47I GGWCC 2 cut(s) 25, 194
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaiI YATR 1 cut(s) 11
FokI GGATG 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 194
Hpy188I TCNGA 2 cut(s) 91, 157
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 194
HpyAV CCTTC 2 cut(s) 86, 136
HpyCH4III ACNGT 2 cut(s) 172, 188
HpyCH4V TGCA 2 cut(s) 125, 139
HpyF3I CTNAG 1 cut(s) 21
Kzo9I GATC 1 cut(s) 43
LguI GCTCTTC 1 cut(s) 101
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 2 cut(s) 26, 36
LweI GCATC 1 cut(s) 7
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 118
MfeI CAATTG 1 cut(s) 57
MflI RGATCY 1 cut(s) 43
MluCI AATT 2 cut(s) 57, 219
MnlI CCTC 2 cut(s) 95, 207
MseI TTAA 2 cut(s) 33, 231
MslI CAYNNNNRTG 1 cut(s) 116
MunI CAATTG 1 cut(s) 57
NdeII GATC 1 cut(s) 43
NlaIV GGNNCC 2 cut(s) 45, 64
PciSI GCTCTTC 1 cut(s) 101
PspN4I GGNNCC 2 cut(s) 45, 64
PspPI GGNCC 2 cut(s) 25, 194
PstI CTGCAG 1 cut(s) 141
PsuI RGATCY 1 cut(s) 43
RsaI GTAC 1 cut(s) 55
RsaNI GTAC 1 cut(s) 54
RseI CAYNNNNRTG 1 cut(s) 116
SapI GCTCTTC 1 cut(s) 101
SaqAI TTAA 2 cut(s) 33, 231
Sau3AI GATC 1 cut(s) 43
Sau96I GGNCC 2 cut(s) 25, 194
SetI ASST 3 cut(s) 55, 147, 199
SfaNI GCATC 1 cut(s) 7
SfcI CTRYAG 2 cut(s) 48, 137
SgeI CNNG 6 cut(s) 41, 53, 63, 193, 212, 221
SinI GGWCC 2 cut(s) 25, 194
SmiMI CAYNNNNRTG 1 cut(s) 116
Sse9I AATT 2 cut(s) 57, 219
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 2 cut(s) 172, 188
TasI AATT 2 cut(s) 57, 219
Tru1I TTAA 2 cut(s) 33, 231
Tru9I TTAA 2 cut(s) 33, 231
TspDTI ATGAA 1 cut(s) 213
VpaK11BI GGWCC 2 cut(s) 25, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.