Rroxscaffold_5G00368310

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0005409
Physical Location & Seq
Reverse (-)
50135541 .. 50136204
664 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00368310.1

Sequence Viewer

Length: 645 bp
ATGGCTTCTTCTTCTTCCTCAATAGCTTGCATTGCTGTAATGTCTTTCCTGGTTCTGATTATTACTACTCCCTCCTCTGCTTTTACCCTAAACAAGGATGTTTGCTCCAACACCAAAGTCTTGAGTCGCTCTTTCTGTTCGCAATTTATGGGTTCTAATCCGGTTGTGATCAAGTCCGTCCTTCTCAGCCTCGCCGAGGCCACTATAGATGTTGCATCTTCGAACGCTAAGAAGACCAGCCAGCTGATAATCAAGTGGCAAAACCAAACAGACAATCCCCAACTGAAGAATGAAATTAGACAGTGTTCTGATTATTACTACTCCCTCCTCTGCTTTTACCCTAAACAAGGATTCTTGAGTCGCTCTTTCTGTTCGCAATTTATGGGTTCTAATCCGGTTGTGATCAAGTCCGTCCTTCTCAGCCTCGCCGAGGCCACTATAGATGTTGCATCTTCGAACGCTAAGAAGACCAGCCAGCTGATAATCAAGTGGCAAAACCAAACAGACAATCCCCAACTGAAGAATGAAATTAGACAGTGTTCTGATTATTACTACTCCCTCCTCTGCTTTTACCCTAAACAAGGATGTTTGCTCCAACACCAAAGTCTTGAGTCGCTCTTTCTGTTCGCAATTTATGGGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

214

Amino Acids

23.88

Weight (kDa)

8.82

Isoelectric Point (pI)

47.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 305, 539
AfiI CCNNNNNNNGG 5 cut(s) 94, 196, 347, 430, 581
AjnI CCWGG 1 cut(s) 48
AluBI AGCT 3 cut(s) 26, 244, 478
AluI AGCT 3 cut(s) 26, 244, 478
AoxI GGCC 2 cut(s) 198, 432
AsuII TTCGAA 2 cut(s) 221, 455
BbsI GAAGAC 2 cut(s) 239, 473
BciT130I CCWGG 1 cut(s) 50
BclI TGATCA 2 cut(s) 168, 402
BfmI CTRYAG 2 cut(s) 204, 438
Bme1390I CCNGG 1 cut(s) 50
BmrFI CCNGG 1 cut(s) 50
BmsI GCATC 2 cut(s) 224, 458
BpiI GAAGAC 2 cut(s) 239, 473
Bpu14I TTCGAA 2 cut(s) 221, 455
BpuEI CTTGAG 3 cut(s) 142, 376, 629
BsaJI CCNNGG 2 cut(s) 195, 429
BsaWI WCCGGW 2 cut(s) 160, 394
Bsc4I CCNNNNNNNGG 5 cut(s) 94, 196, 347, 430, 581
Bse3DI GCAATG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 50
BseDI CCNNGG 2 cut(s) 195, 429
BseGI GGATG 2 cut(s) 103, 590
BseLI CCNNNNNNNGG 5 cut(s) 94, 196, 347, 430, 581
BseMI GCAATG 1 cut(s) 30
BseMII CTCAG 2 cut(s) 199, 433
BseRI GAGGAG 3 cut(s) 64, 317, 551
BshFI GGCC 2 cut(s) 200, 434
BsiSI CCGG 2 cut(s) 161, 395
BslI CCNNNNNNNGG 5 cut(s) 94, 196, 347, 430, 581
BsnI GGCC 2 cut(s) 200, 434
Bsp119I TTCGAA 2 cut(s) 221, 455
Bsp143I GATC 2 cut(s) 168, 402
BspANI GGCC 2 cut(s) 200, 434
BspCNI CTCAG 2 cut(s) 198, 432
BspT104I TTCGAA 2 cut(s) 221, 455
BsrDI GCAATG 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 195, 429
BssMI GATC 2 cut(s) 168, 402
Bst2UI CCWGG 1 cut(s) 50
Bst4CI ACNGT 2 cut(s) 303, 537
BstBI TTCGAA 2 cut(s) 221, 455
BstC8I GCNNGC 3 cut(s) 28, 242, 476
BstDEI CTNAG 4 cut(s) 185, 228, 419, 462
BstENI CCTNNNNNAGG 5 cut(s) 92, 194, 345, 428, 579
BstF5I GGATG 2 cut(s) 103, 590
BstKTI GATC 2 cut(s) 171, 405
BstMBI GATC 2 cut(s) 168, 402
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 48
BstSFI CTRYAG 2 cut(s) 204, 438
BstV2I GAAGAC 2 cut(s) 239, 473
BsuRI GGCC 2 cut(s) 200, 434
BtsCI GGATG 2 cut(s) 103, 590
BtsIMutI CAGTG 2 cut(s) 308, 542
Cac8I GCNNGC 3 cut(s) 28, 242, 476
DdeI CTNAG 4 cut(s) 185, 228, 419, 462
DpnI GATC 2 cut(s) 170, 404
DpnII GATC 2 cut(s) 168, 402
Eco57I CTGAAG 2 cut(s) 305, 539
EcoNI CCTNNNNNAGG 5 cut(s) 92, 194, 345, 428, 579
EcoRII CCWGG 1 cut(s) 48
FaiI YATR 5 cut(s) 149, 206, 383, 440, 636
FbaI TGATCA 2 cut(s) 168, 402
FokI GGATG 2 cut(s) 110, 597
HaeIII GGCC 2 cut(s) 200, 434
HapII CCGG 2 cut(s) 161, 395
HinfI GANTC 4 cut(s) 124, 351, 358, 611
HpaII CCGG 2 cut(s) 161, 395
Hpy188I TCNGA 3 cut(s) 57, 310, 544
Hpy188III TCNNGA 3 cut(s) 121, 355, 608
HpyAV CCTTC 2 cut(s) 191, 425
HpyCH4III ACNGT 2 cut(s) 303, 537
HpyCH4V TGCA 3 cut(s) 30, 215, 449
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 4 cut(s) 185, 228, 419, 462
Ksp22I TGATCA 2 cut(s) 168, 402
Kzo9I GATC 2 cut(s) 168, 402
LmnI GCTCC 2 cut(s) 110, 597
LpnPI CCDG 8 cut(s) 35, 62, 174, 250, 254, 408, 484, 488
LweI GCATC 2 cut(s) 224, 458
MalI GATC 2 cut(s) 170, 404
MboI GATC 2 cut(s) 168, 402
MboII GAAGA 8 cut(s) 3, 6, 210, 244, 298, 444, 478, 532
MluCI AATT 5 cut(s) 143, 294, 377, 528, 630
MlyI GAGTC 3 cut(s) 133, 367, 620
MmeI TCCRAC 2 cut(s) 132, 619
MspA1I CMGCKG 2 cut(s) 244, 478
MspI CCGG 2 cut(s) 161, 395
MspR9I CCNGG 1 cut(s) 50
MvaI CCWGG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 32
NdeII GATC 2 cut(s) 168, 402
NmeAIII GCCGAG 2 cut(s) 220, 454
NspV TTCGAA 2 cut(s) 221, 455
PfeI GAWTC 1 cut(s) 351
PleI GAGTC 3 cut(s) 132, 366, 619
PpsI GAGTC 3 cut(s) 132, 366, 619
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PvuII CAGCTG 2 cut(s) 244, 478
Sau3AI GATC 2 cut(s) 168, 402
SchI GAGTC 3 cut(s) 133, 367, 620
ScrFI CCNGG 1 cut(s) 50
SetI ASST 3 cut(s) 28, 246, 480
SfaNI GCATC 2 cut(s) 224, 458
SfcI CTRYAG 2 cut(s) 204, 438
SfuI TTCGAA 2 cut(s) 221, 455
SmlI CTYRAG 3 cut(s) 121, 355, 608
SmoI CTYRAG 3 cut(s) 121, 355, 608
Sse9I AATT 5 cut(s) 143, 294, 377, 528, 630
StyD4I CCNGG 1 cut(s) 48
TaaI ACNGT 2 cut(s) 303, 537
TaqI TCGA 2 cut(s) 221, 455
TasI AATT 5 cut(s) 143, 294, 377, 528, 630
TfiI GAWTC 1 cut(s) 351
TscAI CASTG 2 cut(s) 308, 542
TspDTI ATGAA 2 cut(s) 306, 540
TspGWI ACGGA 2 cut(s) 166, 400
TspRI CASTG 2 cut(s) 308, 542
XagI CCTNNNNNAGG 5 cut(s) 92, 194, 345, 428, 579
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.