Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000006

Orthogroup ID

OG0001865

Physical Location & Seq

Genomic Coordinates Reverse (-)

36519609 .. 36520598

Gene Structure 990 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_6G00414260.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 156 bp

ATGTTTCCGAGTTTGGTTGCATGGAAGAGATTGGACTGGTTTGCAATCTGGCGAGCGTGTCGCTCGGGCATTATCACTGGTGCAAGATTGAAAGAAGGTTGTCACATAAACGAAGCGTACGACCCCGGGAACTGTAATATGCAAATTAAGGTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

51

Amino Acids

5.87

Weight (kDa)

9.06

Isoelectric Point (pI)

46.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001865)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G24460 AT3G24460 AT4G13345 AT4G13345 AT4G13345 AT4G13345 AT4G13345 AT4G13345 AT4G13345
fragaria_vesca	FvH4_1g05181 FvH4_1g05181 FvH4_1g05181 FvH4_1g05181 FvH4_1g05181
malus_domestica	MD02G1063500.v1.1 MD02G1063900.v1.1 MD15G1188500.v1.1
prunus_persica	Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1 Prupe.7G228000_v2.0.a1
pyrus_communis	pycom02g04240 pycom02g04260 pycom15g16900
rosa_chinensis	RchiOBHm_Chr2g0090921
rosa_laevigata	RLG00000016155
rosa_roxburghii	Rroxscaffold_2G00150750 Rroxscaffold_6G00414260
rosa_rugosa	Rorug02G0010900 Rorug02G0011000 Rorug02G0011000 Rorug02G0011000 Rorug02G0011100 Rorug02G0011100
rosa_samantha	Rh2AG057200 Rh2BG055700 Rh2CG058000 Rh2DG056600
rosa_wichuraiana	Rw2G005220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	119
AgsI	TTSAA	1 cut(s)	91
Ama87I	CYCGRG	2 cut(s)	64, 125
AsuC2I	CCSGG	2 cut(s)	126, 127
AvaI	CYCGRG	2 cut(s)	64, 125
BcnI	CCSGG	2 cut(s)	126, 127
BfaI	CTAG	1 cut(s)	154
Bme1390I	CCNGG	2 cut(s)	126, 127
BmeT110I	CYCGRG	2 cut(s)	64, 125
BmrFI	CCNGG	2 cut(s)	126, 127
BpuMI	CCSGG	2 cut(s)	126, 127
BsaJI	CCNNGG	2 cut(s)	124, 125
Bse1I	ACTGG	2 cut(s)	41, 82
BseDI	CCNNGG	2 cut(s)	124, 125
BseNI	ACTGG	2 cut(s)	41, 82
BsiHKCI	CYCGRG	2 cut(s)	64, 125
BsiSI	CCGG	1 cut(s)	126
BsiWI	CGTACG	1 cut(s)	117
BsoBI	CYCGRG	2 cut(s)	64, 125
BsrI	ACTGG	2 cut(s)	41, 82
BssECI	CCNNGG	2 cut(s)	124, 125
Bst4CI	ACNGT	1 cut(s)	134
Bst6I	CTCTTC	1 cut(s)	20
BstC8I	GCNNGC	1 cut(s)	54
BstSCI	CCNGG	2 cut(s)	124, 125
BtsIMutI	CAGTG	1 cut(s)	75
Cac8I	GCNNGC	1 cut(s)	54
Cfr9I	CCCGGG	1 cut(s)	125
Csp6I	GTAC	1 cut(s)	118
CviAII	CATG	1 cut(s)	21
CviQI	GTAC	1 cut(s)	118
Eam1104I	CTCTTC	1 cut(s)	20
EarI	CTCTTC	1 cut(s)	20
Eco88I	CYCGRG	2 cut(s)	64, 125
FaeI	CATG	1 cut(s)	24
FaiI	YATR	3 cut(s)	22, 107, 140
FatI	CATG	1 cut(s)	20
FspBI	CTAG	1 cut(s)	154
HapII	CCGG	1 cut(s)	126
Hin1II	CATG	1 cut(s)	24
HpaII	CCGG	1 cut(s)	126
Hpy188I	TCNGA	1 cut(s)	9
HpyAV	CCTTC	1 cut(s)	89
HpyCH4III	ACNGT	1 cut(s)	134
HpyCH4V	TGCA	4 cut(s)	20, 44, 83, 142
Hsp92II	CATG	1 cut(s)	24
LpnPI	CCDG	4 cut(s)	22, 34, 63, 139
MaeI	CTAG	1 cut(s)	154
MaeIII	GTNAC	1 cut(s)	101
MboII	GAAGA	1 cut(s)	37
MluCI	AATT	1 cut(s)	144
MseI	TTAA	1 cut(s)	147
MspI	CCGG	1 cut(s)	126
MspR9I	CCNGG	2 cut(s)	126, 127
NciI	CCSGG	2 cut(s)	126, 127
NlaIII	CATG	1 cut(s)	24
NmuCI	GTSAC	1 cut(s)	101
PcsI	WCGNNNNNNNCGW	1 cut(s)	117
Pfl23II	CGTACG	1 cut(s)	117
PspLI	CGTACG	1 cut(s)	117
RsaI	GTAC	1 cut(s)	119
RsaNI	GTAC	1 cut(s)	118
SaqAI	TTAA	1 cut(s)	147
ScrFI	CCNGG	2 cut(s)	126, 127
SetI	ASST	2 cut(s)	100, 153
SmaI	CCCGGG	1 cut(s)	127
Sse9I	AATT	1 cut(s)	144
SspMI	CTAG	1 cut(s)	154
StyD4I	CCNGG	2 cut(s)	124, 125
TaaI	ACNGT	1 cut(s)	134
TasI	AATT	1 cut(s)	144
Tru1I	TTAA	1 cut(s)	147
Tru9I	TTAA	1 cut(s)	147
TscAI	CASTG	1 cut(s)	82
TseFI	GTSAC	1 cut(s)	101
Tsp45I	GTSAC	1 cut(s)	101
TspMI	CCCGGG	1 cut(s)	125
TspRI	CASTG	1 cut(s)	82
XmaI	CCCGGG	1 cut(s)	125
XspI	CTAG	1 cut(s)	154

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.