Rroxscaffold_7G00194690

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
36685417 .. 36687186
1770 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00194690.1

Sequence Viewer

Length: 156 bp
ATGCTTGGAGTTGGTCAAGATTTGGATGCAGAGCTTTGGGGACTTTTAAAGAGATTGGGTTGCAGCTCTCAGCTCGATTCCAACCTATTCACATGCTTCATCAGAGGATTTGCTATACAGAACCAAAAAAGCTTGGAGACAACTTGGCTGGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.68

Weight (kDa)

4.86

Isoelectric Point (pI)

26.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 4 cut(s) 34, 66, 73, 132
AluI AGCT 4 cut(s) 34, 66, 73, 132
Alw26I GTCTC 1 cut(s) 131
ApeKI GCWGC 1 cut(s) 63
BbvI GCAGC 1 cut(s) 75
BcoDI GTCTC 1 cut(s) 131
BisI GCNGC 1 cut(s) 64
BlsI GCNGC 1 cut(s) 65
BmsI GCATC 1 cut(s) 16
BseGI GGATG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 75
BseYI CCCAGC 1 cut(s) 148
BslFI GGGAC 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 54
BspCNI CTCAG 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 31
BstMAI GTCTC 1 cut(s) 131
BstNSI RCATGY 1 cut(s) 96
BstV1I GCAGC 1 cut(s) 75
BtsCI GGATG 1 cut(s) 31
CviAII CATG 1 cut(s) 93
CviJI RGCY 5 cut(s) 34, 66, 73, 132, 148
CviKI_1 RGCY 5 cut(s) 34, 66, 73, 132, 148
DdeI CTNAG 1 cut(s) 69
DraI TTTAAA 1 cut(s) 48
FaeI CATG 1 cut(s) 96
FaiI YATR 2 cut(s) 94, 116
FaqI GGGAC 1 cut(s) 54
FatI CATG 1 cut(s) 92
Fnu4HI GCNGC 1 cut(s) 64
FokI GGATG 1 cut(s) 38
Fsp4HI GCNGC 1 cut(s) 64
GluI GCNGC 1 cut(s) 64
GsaI CCCAGC 1 cut(s) 152
Hin1II CATG 1 cut(s) 96
HindIII AAGCTT 1 cut(s) 130
HinfI GANTC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 104
Hpy188III TCNNGA 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 29, 63
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 1 cut(s) 96
LpnPI CCDG 1 cut(s) 134
Lsp1109I GCAGC 1 cut(s) 75
LweI GCATC 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 1 cut(s) 98
MseI TTAA 1 cut(s) 47
NlaIII CATG 1 cut(s) 96
NspI RCATGY 1 cut(s) 96
PfeI GAWTC 1 cut(s) 77
PkrI GCNGC 1 cut(s) 65
PspFI CCCAGC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 47
SatI GCNGC 1 cut(s) 64
SetI ASST 5 cut(s) 36, 68, 75, 87, 134
SfaNI GCATC 1 cut(s) 16
SgeI CNNG 5 cut(s) 17, 29, 86, 105, 145
TaqI TCGA 1 cut(s) 75
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TseI GCWGC 1 cut(s) 63
TspDTI ATGAA 1 cut(s) 88
XceI RCATGY 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.