Rroxscaffold_7G00200920

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
48391041 .. 48393498
2458 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00200920.1

Sequence Viewer

Length: 318 bp
ATGCTCCCGTATGCGAGCAGCTTGATTAGGTTGAATAGAGGGGATGTTGATTCAAACACTCAGCAGATAATGCTCATATTAGATCTTGATGATCCAATAGAGAAAAAGGACAAAGCATCATTATCGGAGCAGCTGAAGTCTATGCCTAAGTCTATGCCACGGGGTCCAAGGGACTGCCTGGCGCTGAGCAAGCGAGCTTCTATACTACGCAACCTTTATGAGAATCATACCAGTTATGTTATTGATAGAGAAGGAAACTTGACTATGCTGATGCCTTGGTGCTTTCCCGTGAAGTGCCTCCGCTATTTCAGAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

12.22

Weight (kDa)

9.33

Isoelectric Point (pI)

52.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 301
AclWI GGATC 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 155
AgsI TTSAA 2 cut(s) 34, 54
AjnI CCWGG 1 cut(s) 177
AluBI AGCT 3 cut(s) 21, 133, 197
AluI AGCT 3 cut(s) 21, 133, 197
AlwI GGATC 1 cut(s) 86
ApeKI GCWGC 2 cut(s) 18, 130
AspLEI GCGC 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 164
AvaII GGWCC 1 cut(s) 164
BbvI GCAGC 2 cut(s) 30, 142
BcgI CGANNNNNNTGC 2 cut(s) 105, 139
BciT130I CCWGG 1 cut(s) 179
BfoI RGCGCY 1 cut(s) 185
BglII AGATCT 1 cut(s) 82
BisI GCNGC 2 cut(s) 19, 131
BlpI GCTNAGC 1 cut(s) 185
BlsI GCNGC 2 cut(s) 20, 132
Bme1390I CCNGG 1 cut(s) 179
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 164
BmiI GGNNCC 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 179
BmsI GCATC 2 cut(s) 125, 261
Bpu1102I GCTNAGC 1 cut(s) 185
BsaJI CCNNGG 3 cut(s) 158, 167, 275
Bse1I ACTGG 1 cut(s) 231
BseBI CCWGG 1 cut(s) 179
BseDI CCNNGG 3 cut(s) 158, 167, 275
BseGI GGATG 1 cut(s) 49
BseMII CTCAG 2 cut(s) 74, 176
BseNI ACTGG 1 cut(s) 231
BseXI GCAGC 2 cut(s) 30, 142
BslFI GGGAC 1 cut(s) 185
BsmFI GGGAC 1 cut(s) 185
Bsp143I GATC 2 cut(s) 82, 91
Bsp1720I GCTNAGC 1 cut(s) 185
BspACI CCGC 1 cut(s) 301
BspCNI CTCAG 2 cut(s) 73, 177
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 231
BssECI CCNNGG 3 cut(s) 158, 167, 275
BssMI GATC 2 cut(s) 82, 91
BssT1I CCWWGG 2 cut(s) 167, 275
Bst2UI CCWGG 1 cut(s) 179
BstAPI GCANNNNNTGC 1 cut(s) 70
BstC8I GCNNGC 3 cut(s) 16, 191, 195
BstDEI CTNAG 3 cut(s) 60, 147, 185
BstDSI CCRYGG 1 cut(s) 158
BstF5I GGATG 1 cut(s) 49
BstH2I RGCGCY 1 cut(s) 185
BstHHI GCGC 1 cut(s) 184
BstKTI GATC 2 cut(s) 85, 94
BstMBI GATC 2 cut(s) 82, 91
BstMWI GCNNNNNNNGC 2 cut(s) 70, 190
BstNI CCWGG 1 cut(s) 179
BstSCI CCNGG 1 cut(s) 177
BstV1I GCAGC 2 cut(s) 30, 142
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BtgI CCRYGG 1 cut(s) 158
BtsCI GGATG 1 cut(s) 49
Cac8I GCNNGC 3 cut(s) 16, 191, 195
CfoI GCGC 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 164
CviJI RGCY 3 cut(s) 21, 133, 197
CviKI_1 RGCY 3 cut(s) 21, 133, 197
DdeI CTNAG 3 cut(s) 60, 147, 185
DpnI GATC 2 cut(s) 84, 93
DpnII GATC 2 cut(s) 82, 91
Eco130I CCWWGG 2 cut(s) 167, 275
Eco47I GGWCC 1 cut(s) 164
Eco57I CTGAAG 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 177
EcoT14I CCWWGG 2 cut(s) 167, 275
ErhI CCWWGG 2 cut(s) 167, 275
FaiI YATR 9 cut(s) 12, 77, 143, 155, 203, 219, 228, 237, 266
FaqI GGGAC 1 cut(s) 185
Fnu4HI GCNGC 2 cut(s) 19, 131
FokI GGATG 1 cut(s) 56
Fsp4HI GCNGC 2 cut(s) 19, 131
GlaI GCGC 1 cut(s) 183
GluI GCNGC 2 cut(s) 19, 131
HaeII RGCGCY 1 cut(s) 185
HhaI GCGC 1 cut(s) 184
Hin6I GCGC 1 cut(s) 182
HinP1I GCGC 1 cut(s) 182
HinfI GANTC 2 cut(s) 50, 223
Hpy188I TCNGA 2 cut(s) 127, 311
Hpy188III TCNNGA 1 cut(s) 86
HpyAV CCTTC 2 cut(s) 245, 306
HpyF10VI GCNNNNNNNGC 2 cut(s) 70, 190
HpyF3I CTNAG 3 cut(s) 60, 147, 185
HspAI GCGC 1 cut(s) 182
Kzo9I GATC 2 cut(s) 82, 91
LmnI GCTCC 2 cut(s) 9, 127
LpnPI CCDG 3 cut(s) 164, 191, 244
Lsp1109I GCAGC 2 cut(s) 30, 142
LweI GCATC 2 cut(s) 125, 261
MalI GATC 2 cut(s) 84, 93
MboI GATC 2 cut(s) 82, 91
MflI RGATCY 1 cut(s) 82
MnlI CCTC 2 cut(s) 32, 308
MspA1I CMGCKG 1 cut(s) 133
MspR9I CCNGG 1 cut(s) 179
MvaI CCWGG 1 cut(s) 179
MwoI GCNNNNNNNGC 2 cut(s) 70, 190
NdeII GATC 2 cut(s) 82, 91
NlaIV GGNNCC 1 cut(s) 165
PfeI GAWTC 2 cut(s) 50, 223
PkrI GCNGC 2 cut(s) 20, 132
Psp6I CCWGG 1 cut(s) 177
PspGI CCWGG 1 cut(s) 177
PspN4I GGNNCC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 164
PsuI RGATCY 1 cut(s) 82
PvuII CAGCTG 1 cut(s) 133
SatI GCNGC 2 cut(s) 19, 131
Sau3AI GATC 2 cut(s) 82, 91
Sau96I GGNCC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 179
SetI ASST 6 cut(s) 23, 32, 135, 199, 216, 317
SfaNI GCATC 2 cut(s) 125, 261
SinI GGWCC 1 cut(s) 164
SsiI CCGC 1 cut(s) 301
StyD4I CCNGG 1 cut(s) 177
StyI CCWWGG 2 cut(s) 167, 275
TfiI GAWTC 2 cut(s) 50, 223
TseI GCWGC 2 cut(s) 18, 130
VpaK11BI GGWCC 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.