Rh5DG504300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
78859052 .. 78860175
1124 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG504300.1

Sequence Viewer

Length: 201 bp
ATGGCTCTAGAAGAAGAAATCCAAAAGGAGGAAGCTCTAAAAGTTCGTGCGTCTAAAGCTAGTGAAGTGGGTGAAAGAGAGAAGGAAATAGAAACTGAGGTTGCAGAGCTTGAAAGACAAAGGGATGATCTTGAGGCTCAATTGAAAAAGGTTTTGGATTTGCAAGATGATTTCAAGTTGGCTATTGGCTTGATTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.58

Weight (kDa)

4.47

Isoelectric Point (pI)

43.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 3 cut(s) 113, 145, 175
AjuI GAANNNNNNNTTGG 2 cut(s) 137, 169
AluBI AGCT 3 cut(s) 35, 59, 109
AluI AGCT 3 cut(s) 35, 59, 109
AsuHPI GGTGA 1 cut(s) 83
BfaI CTAG 2 cut(s) 8, 60
BpuEI CTTGAG 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseGI GGATG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 28
Bsp143I GATC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 88
BssMI GATC 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 56
BtsCI GGATG 1 cut(s) 130
CseI GACGC 1 cut(s) 39
CviJI RGCY 7 cut(s) 5, 35, 59, 109, 137, 182, 189
CviKI_1 RGCY 7 cut(s) 5, 35, 59, 109, 137, 182, 189
DdeI CTNAG 1 cut(s) 96
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
FokI GGATG 1 cut(s) 137
FspBI CTAG 2 cut(s) 8, 60
HgaI GACGC 1 cut(s) 39
HphI GGTGA 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 8, 131
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 104, 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 1 cut(s) 96
Kzo9I GATC 1 cut(s) 127
MaeI CTAG 2 cut(s) 8, 60
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 2 cut(s) 23, 26
MfeI CAATTG 1 cut(s) 140
MluCI AATT 1 cut(s) 140
MnlI CCTC 3 cut(s) 22, 91, 127
MunI CAATTG 1 cut(s) 140
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeII GATC 1 cut(s) 127
Sau3AI GATC 1 cut(s) 127
SetI ASST 5 cut(s) 37, 61, 102, 111, 153
SgeI CNNG 7 cut(s) 20, 59, 72, 122, 143, 176, 187
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 1 cut(s) 140
SspMI CTAG 2 cut(s) 8, 60
TasI AATT 1 cut(s) 140
XbaI TCTAGA 1 cut(s) 7
XspI CTAG 2 cut(s) 8, 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.