Rw0G013010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00581
OG0011604
Physical Location & Seq
Reverse (-)
17259 .. 21304
4046 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G013010.1

Sequence Viewer

Length: 543 bp
ATGCATGCCATTGGACGTCCTAAAGTCCCGTTCTGTTCAAGAGTTGGAAATCATGCTAAAGTTTCTGAAACGGCTGATATTTTTGGGAGAAGCCTTCATTTCTTATTCAACAGAGCTTATACCTCCAACGGTGACTGGACTATTTATAATTCATTATTGACACGGCAGGTCCAAGGGACTGCCTTGGCAGTTGAGCAAGCAGAGCTTCTATACGACGCAACCTTTATGAGAATCATACCAGTAATGATTGATACGGGAAGCAACTCTGAGAGAATCCAAAAGGAGGAAGCTCTAAAAGTTCGTGCGTCTAAAGCTAGTGAAGTGGGTGAAAGAGAGAAGGAAATAGAAGCTGAGGTTGCAGAGCTTGAAAGACAAAGGGATGATCTTGAGGCTCAATTGAAAAAGAATGGCATGATGCAAAATGGCATCCAAAACAACTCTGACAAGATGCAAAATGGCATCCAAAACAACTCTGACAAGATGCAAAATGGCATCCAAAACCTGCAGAATCAAGTAGACCACAAAATCTGCCGAATCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

180

Amino Acids

20.39

Weight (kDa)

6.92

Isoelectric Point (pI)

21.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 147
AatII GACGTC 1 cut(s) 19
Acc36I ACCTGC 2 cut(s) 157, 510
AccI GTMKAC 1 cut(s) 516
AcyI GRCGYC 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 283
AgsI TTSAA 4 cut(s) 39, 109, 368, 400
AluBI AGCT 6 cut(s) 116, 205, 290, 314, 350, 364
AluI AGCT 6 cut(s) 116, 205, 290, 314, 350, 364
AspS9I GGNCC 1 cut(s) 169
AsuHPI GGTGA 2 cut(s) 143, 338
AvaII GGWCC 1 cut(s) 169
BbvCI CCTCAGC 1 cut(s) 351
BceAI ACGGC 2 cut(s) 87, 179
BfaI CTAG 1 cut(s) 315
BfmI CTRYAG 1 cut(s) 503
BfuAI ACCTGC 2 cut(s) 157, 510
Bme18I GGWCC 1 cut(s) 169
BmgT120I GGNCC 1 cut(s) 169
BmsI GCATC 6 cut(s) 405, 435, 438, 468, 471, 501
Bpu10I CCTNAGC 1 cut(s) 351
BpuEI CTTGAG 1 cut(s) 407
BsaHI GRCGYC 1 cut(s) 16
BsaJI CCNNGG 2 cut(s) 172, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 283
Bse1I ACTGG 2 cut(s) 140, 239
BseDI CCNNGG 2 cut(s) 172, 183
BseGI GGATG 4 cut(s) 385, 426, 459, 492
BseLI CCNNNNNNNGG 1 cut(s) 283
BseMII CTCAG 2 cut(s) 258, 342
BseNI ACTGG 2 cut(s) 140, 239
BslFI GGGAC 2 cut(s) 11, 190
BslI CCNNNNNNNGG 1 cut(s) 283
BsmFI GGGAC 2 cut(s) 11, 190
Bsp143I GATC 1 cut(s) 382
BspCNI CTCAG 2 cut(s) 259, 343
BspMAI CTGCAG 1 cut(s) 507
BspMI ACCTGC 2 cut(s) 157, 510
BsrI ACTGG 2 cut(s) 140, 239
BssECI CCNNGG 2 cut(s) 172, 183
BssMI GATC 1 cut(s) 382
BssNI GRCGYC 1 cut(s) 16
BssT1I CCWWGG 2 cut(s) 172, 183
Bst4CI ACNGT 1 cut(s) 131
BstACI GRCGYC 1 cut(s) 16
BstC8I GCNNGC 2 cut(s) 6, 198
BstDEI CTNAG 2 cut(s) 267, 351
BstF5I GGATG 4 cut(s) 385, 426, 459, 492
BstKTI GATC 1 cut(s) 385
BstMBI GATC 1 cut(s) 382
BstMWI GCNNNNNNNGC 3 cut(s) 202, 311, 356
BstNSI RCATGY 1 cut(s) 8
BstSFI CTRYAG 1 cut(s) 503
BtsCI GGATG 4 cut(s) 385, 426, 459, 492
BveI ACCTGC 2 cut(s) 157, 510
Cac8I GCNNGC 2 cut(s) 6, 198
Cfr13I GGNCC 1 cut(s) 169
CseI GACGC 2 cut(s) 224, 294
CviAII CATG 3 cut(s) 5, 53, 412
CviJI RGCY 9 cut(s) 74, 93, 116, 205, 290, 314, 350, 364, 392
CviKI_1 RGCY 9 cut(s) 74, 93, 116, 205, 290, 314, 350, 364, 392
DdeI CTNAG 2 cut(s) 267, 351
DpnI GATC 1 cut(s) 384
DpnII GATC 1 cut(s) 382
Eco130I CCWWGG 2 cut(s) 172, 183
Eco47I GGWCC 1 cut(s) 169
EcoT14I CCWWGG 2 cut(s) 172, 183
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 2 cut(s) 172, 183
FaeI CATG 3 cut(s) 8, 56, 415
FaiI YATR 8 cut(s) 6, 54, 120, 147, 211, 227, 236, 413
FalI AAGNNNNNCTT 2 cut(s) 189, 221
FaqI GGGAC 2 cut(s) 11, 190
FatI CATG 3 cut(s) 4, 52, 411
FblI GTMKAC 1 cut(s) 516
FokI GGATG 4 cut(s) 392, 413, 446, 479
FspBI CTAG 1 cut(s) 315
HgaI GACGC 2 cut(s) 224, 294
Hin1I GRCGYC 1 cut(s) 16
Hin1II CATG 3 cut(s) 8, 56, 415
HinfI GANTC 4 cut(s) 231, 273, 508, 534
HphI GGTGA 2 cut(s) 143, 338
Hpy166II GTNNAC 1 cut(s) 517
Hpy188I TCNGA 4 cut(s) 67, 268, 442, 475
Hpy188III TCNNGA 2 cut(s) 39, 386
Hpy8I GTNNAC 1 cut(s) 517
Hpy99I CGWCG 1 cut(s) 218
HpyAV CCTTC 2 cut(s) 104, 331
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4IV ACGT 1 cut(s) 16
HpyCH4V TGCA 6 cut(s) 4, 359, 418, 451, 484, 505
HpyF10VI GCNNNNNNNGC 3 cut(s) 202, 311, 356
HpyF3I CTNAG 2 cut(s) 267, 351
HpySE526I ACGT 1 cut(s) 16
Hsp92I GRCGYC 1 cut(s) 16
Hsp92II CATG 3 cut(s) 8, 56, 415
Kzo9I GATC 1 cut(s) 382
LpnPI CCDG 4 cut(s) 121, 152, 252, 515
LweI GCATC 6 cut(s) 405, 435, 438, 468, 471, 501
MaeI CTAG 1 cut(s) 315
MaeII ACGT 1 cut(s) 16
MaeIII GTNAC 1 cut(s) 131
MalI GATC 1 cut(s) 384
MboI GATC 1 cut(s) 382
MfeI CAATTG 1 cut(s) 395
MluCI AATT 2 cut(s) 148, 395
MmeI TCCRAC 2 cut(s) 25, 150
MnlI CCTC 4 cut(s) 133, 277, 346, 382
Mph1103I ATGCAT 1 cut(s) 6
MunI CAATTG 1 cut(s) 395
MwoI GCNNNNNNNGC 3 cut(s) 202, 311, 356
NdeII GATC 1 cut(s) 382
NlaIII CATG 3 cut(s) 8, 56, 415
NmuCI GTSAC 1 cut(s) 131
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PaeI GCATGC 1 cut(s) 8
PfeI GAWTC 4 cut(s) 231, 273, 508, 534
PsiI TTATAA 1 cut(s) 147
PspPI GGNCC 1 cut(s) 169
PstI CTGCAG 1 cut(s) 507
Sau3AI GATC 1 cut(s) 382
Sau96I GGNCC 1 cut(s) 169
SfaNI GCATC 6 cut(s) 405, 435, 438, 468, 471, 501
SfcI CTRYAG 1 cut(s) 503
SinI GGWCC 1 cut(s) 169
SmlI CTYRAG 1 cut(s) 386
SmoI CTYRAG 1 cut(s) 386
SphI GCATGC 1 cut(s) 8
Sse9I AATT 2 cut(s) 148, 395
SspMI CTAG 1 cut(s) 315
StyI CCWWGG 2 cut(s) 172, 183
TaaI ACNGT 1 cut(s) 131
TaiI ACGT 1 cut(s) 19
TasI AATT 2 cut(s) 148, 395
TfiI GAWTC 4 cut(s) 231, 273, 508, 534
TseFI GTSAC 1 cut(s) 131
Tsp45I GTSAC 1 cut(s) 131
TspDTI ATGAA 2 cut(s) 86, 141
VpaK11BI GGWCC 1 cut(s) 169
XceI RCATGY 1 cut(s) 8
XmiI GTMKAC 1 cut(s) 516
XspI CTAG 1 cut(s) 315
ZraI GACGTC 1 cut(s) 17
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.