Rorug01G0085800

Porphobilinogen deaminase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
13929597 .. 13929911
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0085800.1

Sequence Viewer

Length: 315 bp
ATGGTCAACGACTTGGTTAGTGACATGATCTGTGAATTCGTAAGTGGCATGAACTGTGACACGGTGAGTGACTTGATTAGTGATATGAACTGTGACACAGTGAGCGACTTAGTCAGTAGTATGATTTGTGACTTTGTCAGCAGAACTTCTTTTTGTGTTCTAACAAGCAAATCACTAACTAAATGTTACATAAACACAACTTTTAATGGTATGACATTAAAGGGGGGGGTGAAATTTGCACACCCCATATTACAAACCACACACCCTTCTATTATTTTAATAATATTTTATCTAACATCTCTTTTCACTTCCTAA

Protein Analysis

104

Amino Acids

11.44

Weight (kDa)

4.64

Isoelectric Point (pI)

22.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 35, 233
ApoI RAATTY 2 cut(s) 35, 233
AsuHPI GGTGA 2 cut(s) 76, 241
Bsp143I GATC 1 cut(s) 27
BssMI GATC 1 cut(s) 27
Bst4CI ACNGT 4 cut(s) 56, 64, 92, 100
BstDEI CTNAG 1 cut(s) 109
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 105
CviAII CATG 2 cut(s) 25, 49
DdeI CTNAG 1 cut(s) 109
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
EcoRI GAATTC 1 cut(s) 35
FaeI CATG 2 cut(s) 28, 52
FaiI YATR 7 cut(s) 26, 50, 86, 122, 191, 212, 248
FatI CATG 2 cut(s) 24, 48
Hin1II CATG 2 cut(s) 28, 52
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HphI GGTGA 2 cut(s) 76, 241
Hpy166II GTNNAC 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 276
HpyCH4III ACNGT 4 cut(s) 56, 64, 92, 100
HpyCH4V TGCA 1 cut(s) 239
HpyF3I CTNAG 1 cut(s) 109
Hsp92II CATG 2 cut(s) 28, 52
Kzo9I GATC 1 cut(s) 27
MaeIII GTNAC 6 cut(s) 20, 56, 68, 92, 128, 185
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MluCI AATT 2 cut(s) 35, 233
MseI TTAA 3 cut(s) 204, 218, 278
NdeII GATC 1 cut(s) 27
NlaIII CATG 2 cut(s) 28, 52
NmuCI GTSAC 5 cut(s) 20, 56, 68, 92, 128
PflFI GACNNNGTC 2 cut(s) 110, 134
PsyI GACNNNGTC 2 cut(s) 110, 134
SaqAI TTAA 3 cut(s) 204, 218, 278
Sau3AI GATC 1 cut(s) 27
SgeI CNNG 6 cut(s) 25, 37, 61, 73, 85, 177
Sse9I AATT 2 cut(s) 35, 233
SspI AATATT 1 cut(s) 285
TaaI ACNGT 4 cut(s) 56, 64, 92, 100
TasI AATT 2 cut(s) 35, 233
Tru1I TTAA 3 cut(s) 204, 218, 278
Tru9I TTAA 3 cut(s) 204, 218, 278
TscAI CASTG 1 cut(s) 105
TseFI GTSAC 5 cut(s) 20, 56, 68, 92, 128
Tsp45I GTSAC 5 cut(s) 20, 56, 68, 92, 128
TspDTI ATGAA 2 cut(s) 65, 101
TspRI CASTG 1 cut(s) 105
Tth111I GACNNNGTC 2 cut(s) 110, 134
XapI RAATTY 2 cut(s) 35, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.