Rorug01G0252800

receptor-like protein kinase At5g24010

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0006847
Physical Location & Seq
Reverse (-)
36168994 .. 36169703
710 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0252800.1

Sequence Viewer

Length: 321 bp
ATGGTTTTGGGGTTTACAGAATTTGTTGTTGGAGGTAACGACGGCTGGAAAGCTGGAGTAGTTGATTACTCTGCTTGGGCTTCTGGCTATACGTTTAGTGCTGGAGATGTTTTAGTTTTCAATTATTGGGACACAACTGAATATAATGTCGTTGTAGCAACTGGTTCTGATACATTTGATAAATGTGTTTCAACTCCAAACTTGGGTTTTTATGATACTGGCCATGATGTGCTAACGTTGACAGATGCTGGGAACTACTATTTCTTCTGTGATGAGCACTGTGAATATGGCGAGATGAAATTTATGATAACTGTAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Malectin_like

Protein Analysis

106

Amino Acids

11.75

Weight (kDa)

4.05

Isoelectric Point (pI)

10.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 16 - 97 1.8e-16 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 236
AcoI YGGCCR 1 cut(s) 220
AcsI RAATTY 2 cut(s) 20, 299
AfiI CCNNNNNNNGG 1 cut(s) 203
AgsI TTSAA 2 cut(s) 121, 192
AjuI GAANNNNNNNTTGG 2 cut(s) 12, 44
AluBI AGCT 2 cut(s) 53, 318
AluI AGCT 2 cut(s) 53, 318
Alw21I GWGCWC 1 cut(s) 279
AlwNI CAGNNNCTG 1 cut(s) 248
AoxI GGCC 1 cut(s) 220
ApoI RAATTY 2 cut(s) 20, 299
BalI TGGCCA 1 cut(s) 222
Bbv12I GWGCWC 1 cut(s) 279
BceAI ACGGC 1 cut(s) 58
BmsI GCATC 1 cut(s) 235
BpmI CTGGAG 2 cut(s) 75, 123
Bsc4I CCNNNNNNNGG 1 cut(s) 203
Bse1I ACTGG 2 cut(s) 166, 223
BseLI CCNNNNNNNGG 1 cut(s) 203
BseNI ACTGG 2 cut(s) 166, 223
BseYI CCCAGC 1 cut(s) 248
BshFI GGCC 1 cut(s) 222
BsiHKAI GWGCWC 1 cut(s) 279
BslFI GGGAC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 143
BsnI GGCC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 279
BspANI GGCC 1 cut(s) 222
BsrI ACTGG 2 cut(s) 166, 223
Bst4CI ACNGT 2 cut(s) 281, 313
BsuRI GGCC 1 cut(s) 222
BtsIMutI CAGTG 1 cut(s) 277
CaiI CAGNNNCTG 1 cut(s) 248
CviAII CATG 1 cut(s) 224
CviJI RGCY 6 cut(s) 45, 53, 80, 87, 222, 318
CviKI_1 RGCY 6 cut(s) 45, 53, 80, 87, 222, 318
EaeI YGGCCR 1 cut(s) 220
FaeI CATG 1 cut(s) 227
FaiI YATR 6 cut(s) 90, 144, 213, 225, 288, 305
FaqI GGGAC 1 cut(s) 143
FatI CATG 1 cut(s) 223
GsaI CCCAGC 1 cut(s) 252
GsuI CTGGAG 2 cut(s) 75, 123
HaeIII GGCC 1 cut(s) 222
Hin1II CATG 1 cut(s) 227
HincII GTYRAC 1 cut(s) 240
HindII GTYRAC 1 cut(s) 240
Hpy166II GTNNAC 2 cut(s) 15, 240
Hpy188I TCNGA 1 cut(s) 169
Hpy8I GTNNAC 2 cut(s) 15, 240
Hpy99I CGWCG 1 cut(s) 44
HpyCH4III ACNGT 2 cut(s) 281, 313
HpyCH4IV ACGT 2 cut(s) 92, 236
HpySE526I ACGT 2 cut(s) 92, 236
Hsp92II CATG 1 cut(s) 227
LpnPI CCDG 7 cut(s) 31, 39, 69, 87, 147, 204, 234
LweI GCATC 1 cut(s) 235
MaeII ACGT 2 cut(s) 92, 236
MaeIII GTNAC 1 cut(s) 35
MboII GAAGA 1 cut(s) 256
MhlI GDGCHC 1 cut(s) 279
MlsI TGGCCA 1 cut(s) 222
MluCI AATT 3 cut(s) 20, 121, 299
MluNI TGGCCA 1 cut(s) 222
MmeI TCCRAC 1 cut(s) 10
MnlI CCTC 1 cut(s) 26
Mox20I TGGCCA 1 cut(s) 222
MscI TGGCCA 1 cut(s) 222
Msp20I TGGCCA 1 cut(s) 222
NlaIII CATG 1 cut(s) 227
Psp1406I AACGTT 1 cut(s) 236
PspFI CCCAGC 1 cut(s) 248
PstNI CAGNNNCTG 1 cut(s) 248
SduI GDGCHC 1 cut(s) 279
SetI ASST 5 cut(s) 37, 55, 95, 239, 320
SfaNI GCATC 1 cut(s) 235
Sse9I AATT 3 cut(s) 20, 121, 299
TaaI ACNGT 2 cut(s) 281, 313
TaiI ACGT 2 cut(s) 95, 239
TasI AATT 3 cut(s) 20, 121, 299
TscAI CASTG 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 311
TspRI CASTG 1 cut(s) 284
XapI RAATTY 2 cut(s) 20, 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.