Rorug03G0114300

Belongs to the glutamine synthetase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
9296503 .. 9298651
2149 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0114300.1

Sequence Viewer

Length: 210 bp
ATGGCCGGTGGTGGAAATTTCGTTAACAGAGTCATGTCATACCTCGTCAATGAGCTTCTGGTCGATAGCCTCGCCAACAGCAAATCATTCCAGAGGTTTGCTGTGAGGACATCAAAGCAGATGGATGAGCTTTCAAATTTGGCTTCCAAGAAGAAGGAACAACTTGCCGAGCAGATGAAGGATATCTCCAATTCTCTCAAAGATCGGTGA

Protein Analysis

69

Amino Acids

7.77

Weight (kDa)

9.52

Isoelectric Point (pI)

25.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 16, 136
AgsI TTSAA 1 cut(s) 135
AluBI AGCT 2 cut(s) 55, 130
AluI AGCT 2 cut(s) 55, 130
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 16, 136
BccI CCATC 1 cut(s) 115
Bse118I RCCGGY 1 cut(s) 5
BseGI GGATG 1 cut(s) 130
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 6
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 202
BspANI GGCC 1 cut(s) 5
BsrFI RCCGGY 1 cut(s) 5
BssAI RCCGGY 1 cut(s) 5
BssMI GATC 1 cut(s) 202
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 130
Cfr10I RCCGGY 1 cut(s) 5
CviAII CATG 1 cut(s) 34
CviJI RGCY 5 cut(s) 5, 55, 69, 130, 143
CviKI_1 RGCY 5 cut(s) 5, 55, 69, 130, 143
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
EaeI YGGCCR 1 cut(s) 3
Eco32I GATATC 1 cut(s) 184
EcoRV GATATC 1 cut(s) 184
FaeI CATG 1 cut(s) 37
FaiI YATR 2 cut(s) 35, 40
FatI CATG 1 cut(s) 33
FokI GGATG 1 cut(s) 137
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 6
Hin1II CATG 1 cut(s) 37
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 1 cut(s) 30
HpaI GTTAAC 1 cut(s) 25
HpaII CCGG 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 25
Hpy188III TCNNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 148, 172
Hsp92II CATG 1 cut(s) 37
KspAI GTTAAC 1 cut(s) 25
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 3 cut(s) 19, 44, 104
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 1 cut(s) 163
MluCI AATT 3 cut(s) 16, 136, 190
MlyI GAGTC 1 cut(s) 39
MnlI CCTC 4 cut(s) 53, 80, 87, 99
MseI TTAA 1 cut(s) 24
MspI CCGG 1 cut(s) 6
NdeII GATC 1 cut(s) 202
NlaIII CATG 1 cut(s) 37
NmeAIII GCCGAG 1 cut(s) 193
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 24
Sau3AI GATC 1 cut(s) 202
SchI GAGTC 1 cut(s) 39
SetI ASST 4 cut(s) 45, 57, 98, 132
SgeI CNNG 9 cut(s) 18, 46, 56, 71, 83, 103, 160, 176, 181
Sse9I AATT 3 cut(s) 16, 136, 190
TaqI TCGA 1 cut(s) 63
TasI AATT 3 cut(s) 16, 136, 190
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 191
XapI RAATTY 2 cut(s) 16, 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.