Rorug03G0348400

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
42465851 .. 42469328
3478 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0348400.1

Sequence Viewer

Length: 546 bp
ATGGGGCTTAGTTTAGAGATACATGCAATTGAGGTTGTTGGGTATCAGAAAGTAGGGAACTTTGTTTCTGGGGAATGGCATATGTGCTTTGCTGAGTTAGGAAAGGTACGAGCTAGGCGCCCTCAACAAAAGAAAAAGTTCCAAAGAGACGAGGGCTTTAGGAGACGTGTTTCCATGTTTTCATCTGGTTGGCGGATGGGACAATCAGTAAAAATTAACACCGCTTATCTCAGTGAGCTGATTTTGAAAGAGTGGAAGAAAAAGAAGCATGCACATTGGCGCTACAGAAACGCACGTACAGAGTTGATGACACACGATATTGGTCACATTAAACGAACTTGGAGAAAGGTTTTGCGCATTAGGAGGCAAAAGCATCGTGAACAAAACAGCTTTTTGGCTAAGTTCTTCATCAAGCGTTTTGAGGATTTGAAACATGATATTGAGAACTCTTCCAATAATTGGACCAAGGGTGTTGCAGTAAGGGAATTATCTAACTTCATGTATGGGCAACGATTGTTGACAAATGGATGGCTCAGATGGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

181

Amino Acids

21.86

Weight (kDa)

10.89

Isoelectric Point (pI)

42.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 356
AccB1I GGYRCC 1 cut(s) 117
AccB7I CCANNNNNTGG 1 cut(s) 459
AciI CCGC 2 cut(s) 193, 222
AcyI GRCGYC 1 cut(s) 118
AfaI GTAC 2 cut(s) 108, 298
AfiI CCNNNNNNNGG 1 cut(s) 459
AflIII ACRYGT 1 cut(s) 166
AgsI TTSAA 2 cut(s) 247, 430
AjiI CACGTC 1 cut(s) 167
AluBI AGCT 3 cut(s) 113, 238, 390
AluI AGCT 3 cut(s) 113, 238, 390
Alw26I GTCTC 2 cut(s) 141, 157
Asp700I GAANNNNTTC 1 cut(s) 137
AspLEI GCGC 3 cut(s) 120, 282, 357
AspS9I GGNCC 1 cut(s) 462
AvaII GGWCC 1 cut(s) 462
BanI GGYRCC 1 cut(s) 117
BccI CCATC 3 cut(s) 190, 522, 531
BcgI CGANNNNNNTGC 2 cut(s) 356, 390
BcoDI GTCTC 2 cut(s) 141, 157
BfaI CTAG 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 283
BfoI RGCGCY 2 cut(s) 121, 283
Bme18I GGWCC 1 cut(s) 462
BmgBI CACGTC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 462
BmiI GGNNCC 1 cut(s) 119
BmsI GCATC 1 cut(s) 382
BsaAI YACGTR 1 cut(s) 296
BsaHI GRCGYC 1 cut(s) 118
BsaJI CCNNGG 1 cut(s) 465
Bsc4I CCNNNNNNNGG 1 cut(s) 459
BseDI CCNNGG 1 cut(s) 465
BseGI GGATG 2 cut(s) 201, 533
BseLI CCNNNNNNNGG 1 cut(s) 459
BseMII CTCAG 2 cut(s) 84, 244
BshNI GGYRCC 1 cut(s) 117
BslFI GGGAC 1 cut(s) 213
BslI CCNNNNNNNGG 1 cut(s) 459
BsmAI GTCTC 2 cut(s) 141, 157
BsmBI CGTCTC 2 cut(s) 141, 157
BsmFI GGGAC 1 cut(s) 213
BspACI CCGC 2 cut(s) 193, 222
BspCNI CTCAG 3 cut(s) 85, 243, 546
BspLI GGNNCC 1 cut(s) 119
BspT107I GGYRCC 1 cut(s) 117
BssECI CCNNGG 1 cut(s) 465
BssNI GRCGYC 1 cut(s) 118
BssT1I CCWWGG 1 cut(s) 465
Bst6I CTCTTC 1 cut(s) 454
BstACI GRCGYC 1 cut(s) 118
BstBAI YACGTR 1 cut(s) 296
BstC8I GCNNGC 1 cut(s) 270
BstDEI CTNAG 5 cut(s) 8, 93, 230, 399, 533
BstF5I GGATG 2 cut(s) 201, 533
BstH2I RGCGCY 2 cut(s) 121, 283
BstHHI GCGC 3 cut(s) 120, 282, 357
BstMAI GTCTC 2 cut(s) 141, 157
BstNSI RCATGY 2 cut(s) 26, 272
BstSFI CTRYAG 1 cut(s) 283
BtrI CACGTC 1 cut(s) 167
BtsCI GGATG 2 cut(s) 201, 533
BtsIMutI CAGTG 1 cut(s) 238
Cac8I GCNNGC 1 cut(s) 270
CfoI GCGC 3 cut(s) 120, 282, 357
Cfr13I GGNCC 1 cut(s) 462
Csp6I GTAC 2 cut(s) 107, 297
CviAII CATG 5 cut(s) 23, 175, 269, 434, 499
CviJI RGCY 7 cut(s) 7, 113, 156, 238, 390, 398, 532
CviKI_1 RGCY 7 cut(s) 7, 113, 156, 238, 390, 398, 532
CviQI GTAC 2 cut(s) 107, 297
DdeI CTNAG 5 cut(s) 8, 93, 230, 399, 533
DinI GGCGCC 1 cut(s) 119
Eam1104I CTCTTC 1 cut(s) 454
EarI CTCTTC 1 cut(s) 454
EciI GGCGGA 1 cut(s) 208
Eco130I CCWWGG 1 cut(s) 465
Eco47I GGWCC 1 cut(s) 462
EcoT14I CCWWGG 1 cut(s) 465
EgeI GGCGCC 1 cut(s) 119
EheI GGCGCC 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 465
Esp3I CGTCTC 2 cut(s) 141, 157
FaeI CATG 5 cut(s) 26, 178, 272, 437, 502
FaiI YATR 8 cut(s) 24, 81, 83, 176, 270, 435, 500, 504
FaqI GGGAC 1 cut(s) 213
FatI CATG 5 cut(s) 22, 174, 268, 433, 498
FauNDI CATATG 1 cut(s) 81
FokI GGATG 2 cut(s) 208, 540
FspBI CTAG 1 cut(s) 114
FspI TGCGCA 1 cut(s) 356
GlaI GCGC 3 cut(s) 119, 281, 356
HaeII RGCGCY 2 cut(s) 121, 283
HhaI GCGC 3 cut(s) 120, 282, 357
Hin1I GRCGYC 1 cut(s) 118
Hin1II CATG 5 cut(s) 26, 178, 272, 437, 502
Hin6I GCGC 3 cut(s) 118, 280, 355
HinP1I GCGC 3 cut(s) 118, 280, 355
HincII GTYRAC 1 cut(s) 519
HindII GTYRAC 1 cut(s) 519
Hpy166II GTNNAC 2 cut(s) 380, 519
Hpy188I TCNGA 2 cut(s) 48, 536
Hpy188III TCNNGA 1 cut(s) 377
Hpy8I GTNNAC 2 cut(s) 380, 519
HpyCH4IV ACGT 2 cut(s) 166, 295
HpyCH4V TGCA 3 cut(s) 26, 272, 476
HpyF3I CTNAG 5 cut(s) 8, 93, 230, 399, 533
HpySE526I ACGT 2 cut(s) 166, 295
Hsp92I GRCGYC 1 cut(s) 118
Hsp92II CATG 5 cut(s) 26, 178, 272, 437, 502
HspAI GCGC 3 cut(s) 118, 280, 355
KasI GGCGCC 1 cut(s) 117
LpnPI CCDG 2 cut(s) 54, 171
LweI GCATC 1 cut(s) 382
MaeI CTAG 1 cut(s) 114
MaeII ACGT 2 cut(s) 166, 295
MaeIII GTNAC 1 cut(s) 323
MboII GAAGA 3 cut(s) 268, 397, 441
MfeI CAATTG 1 cut(s) 27
MluCI AATT 4 cut(s) 27, 213, 457, 485
Mly113I GGCGCC 1 cut(s) 118
MnlI CCTC 5 cut(s) 25, 132, 145, 357, 415
MroXI GAANNNNTTC 1 cut(s) 137
MseI TTAA 2 cut(s) 216, 330
MunI CAATTG 1 cut(s) 27
NarI GGCGCC 1 cut(s) 118
NdeI CATATG 1 cut(s) 81
NlaIII CATG 5 cut(s) 26, 178, 272, 437, 502
NlaIV GGNNCC 1 cut(s) 119
NmuCI GTSAC 1 cut(s) 323
NsbI TGCGCA 1 cut(s) 356
NspI RCATGY 2 cut(s) 26, 272
PaeI GCATGC 1 cut(s) 272
PdmI GAANNNNTTC 1 cut(s) 137
PflMI CCANNNNNTGG 1 cut(s) 459
PluTI GGCGCC 1 cut(s) 121
Ppu21I YACGTR 1 cut(s) 296
PspN4I GGNNCC 1 cut(s) 119
PspPI GGNCC 1 cut(s) 462
RsaI GTAC 2 cut(s) 108, 298
RsaNI GTAC 2 cut(s) 107, 297
SaqAI TTAA 2 cut(s) 216, 330
Sau96I GGNCC 1 cut(s) 462
SetI ASST 8 cut(s) 36, 108, 115, 169, 240, 298, 351, 392
SfaNI GCATC 1 cut(s) 382
SfcI CTRYAG 1 cut(s) 283
SfoI GGCGCC 1 cut(s) 119
SinI GGWCC 1 cut(s) 462
SphI GCATGC 1 cut(s) 272
Sse9I AATT 4 cut(s) 27, 213, 457, 485
SsiI CCGC 2 cut(s) 193, 222
SspDI GGCGCC 1 cut(s) 117
SspMI CTAG 1 cut(s) 114
StyI CCWWGG 1 cut(s) 465
TaiI ACGT 2 cut(s) 169, 298
TasI AATT 4 cut(s) 27, 213, 457, 485
Tru1I TTAA 2 cut(s) 216, 330
Tru9I TTAA 2 cut(s) 216, 330
TscAI CASTG 1 cut(s) 238
TseFI GTSAC 1 cut(s) 323
Tsp45I GTSAC 1 cut(s) 323
TspDTI ATGAA 3 cut(s) 171, 397, 487
TspRI CASTG 1 cut(s) 238
Van91I CCANNNNNTGG 1 cut(s) 459
VpaK11BI GGWCC 1 cut(s) 462
XceI RCATGY 2 cut(s) 26, 272
XmnI GAANNNNTTC 1 cut(s) 137
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.