Rw4G005650

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0005053
Physical Location & Seq
Forward (+)
11373795 .. 11374546
752 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G005650.1

Sequence Viewer

Length: 720 bp
ATGGTCAAGCAATTATCATCAGTCTATTCCATTTTGCTCTCTATTCTATTTGCCTCAGTCCATGTACTACTGGTCAATGCAGCAGTTGACCCAGTCAGGGCCAGTGAACATGAACCAATTCTTGAGATGTACATGCATGATATTCTTGGGGGCAGCAGCCCAACAGCTAGGCCTATAACTGGTCTGCTAGGCAACATCTATGGAGGTCAAGTTCCCTTTGCAAAGCCAATAGGGTTCCTTCCCCCACAAGGTGGTGTCCCCATCCCCAATGCCAATGGTGCCCTCCCTACTGTCAATGGCATCAATGGGATCCCTCTTGGAACCGGCTTGTCCGGCACAACGTTTTCGGGAAAGCCCATTGGGCAGGCCCAGACCCAGTTGGGCCCTGATGGTCTGAGCCTGGGCTTCGGCACTATCACTGTCATTGATGACAGTCTCACCACAGCACCTGAGCTAGGGTCACAGAGTATTGGTAAAGCACAAGGGGTTTATGTGGCAAGTTCAGCAGATGGGTCAAGACAGATGATGGCATTCACTGCTATGATTGAAGGAGGTGAGTATGGTGATAGTCTCAACTTCTATGGTGTGTTTAAGATTGGAAGCCCAATGTCACATTTTGCTAGTGGTTTTGCTGAGGTGAGATCACTAATCCCTCCTGGTCAACATATTACTGATGGTGCAGAGACTCTGCTGAGGATCATCGTACATCTAAGCTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

239

Amino Acids

24.72

Weight (kDa)

5.38

Isoelectric Point (pI)

42.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 131 - 200 1.5e-14 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 278
AccB7I CCANNNNNTGG 1 cut(s) 251
AclI AACGTT 1 cut(s) 341
AclWI GGATC 3 cut(s) 304, 317, 704
AdeI CACNNNGTG 1 cut(s) 251
AfaI GTAC 3 cut(s) 66, 131, 705
AfiI CCNNNNNNNGG 5 cut(s) 97, 179, 248, 251, 455
AgsI TTSAA 1 cut(s) 548
AjnI CCWGG 2 cut(s) 399, 655
AloI GAACNNNNNNTCC 2 cut(s) 195, 227
AluBI AGCT 3 cut(s) 167, 454, 714
AluI AGCT 3 cut(s) 167, 454, 714
Alw26I GTCTC 3 cut(s) 440, 575, 677
AlwI GGATC 3 cut(s) 304, 317, 704
AlwNI CAGNNNCTG 1 cut(s) 449
AoxI GGCC 4 cut(s) 99, 170, 366, 382
ApaI GGGCCC 1 cut(s) 386
ApeKI GCWGC 3 cut(s) 80, 153, 156
Asp700I GAANNNNTTC 1 cut(s) 117
AspS9I GGNCC 4 cut(s) 99, 367, 382, 383
AsuHPI GGTGA 4 cut(s) 430, 566, 575, 649
BaeGI GKGCMC 2 cut(s) 283, 386
BamHI GGATCC 1 cut(s) 309
BanI GGYRCC 1 cut(s) 278
BanII GRGCYC 1 cut(s) 386
BbvCI CCTCAGC 2 cut(s) 633, 692
BbvI GCAGC 3 cut(s) 92, 165, 168
BccI CCATC 5 cut(s) 269, 383, 503, 520, 668
BciT130I CCWGG 2 cut(s) 401, 657
BcoDI GTCTC 3 cut(s) 440, 575, 677
BfaI CTAG 4 cut(s) 168, 188, 455, 621
BglI GCCNNNNNGGC 1 cut(s) 361
BisI GCNGC 3 cut(s) 81, 154, 157
BlsI GCNGC 3 cut(s) 82, 155, 158
Bme1390I CCNGG 2 cut(s) 401, 657
BmgT120I GGNCC 4 cut(s) 99, 367, 382, 383
BmiI GGNNCC 5 cut(s) 236, 280, 311, 322, 384
BmrFI CCNGG 2 cut(s) 401, 657
BmrI ACTGGG 2 cut(s) 86, 370
BmsI GCATC 1 cut(s) 309
BmuI ACTGGG 2 cut(s) 86, 370
Bpu10I CCTNAGC 3 cut(s) 450, 633, 692
BpuEI CTTGAG 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 400
BsaXI ACNNNNNCTCC 2 cut(s) 195, 225
Bsc4I CCNNNNNNNGG 5 cut(s) 97, 179, 248, 251, 455
Bse118I RCCGGY 1 cut(s) 323
Bse1I ACTGG 5 cut(s) 75, 92, 102, 184, 376
BseBI CCWGG 2 cut(s) 401, 657
BseDI CCNNGG 1 cut(s) 400
BseGI GGATG 1 cut(s) 261
BseLI CCNNNNNNNGG 5 cut(s) 97, 179, 248, 251, 455
BseMII CTCAG 5 cut(s) 69, 386, 441, 624, 683
BseNI ACTGG 5 cut(s) 75, 92, 102, 184, 376
BseSI GKGCMC 2 cut(s) 283, 386
BseXI GCAGC 3 cut(s) 92, 165, 168
BsgI GTGCAG 1 cut(s) 699
BshFI GGCC 4 cut(s) 101, 172, 368, 384
BshNI GGYRCC 1 cut(s) 278
BsiSI CCGG 2 cut(s) 324, 333
BslFI GGGAC 1 cut(s) 242
BslI CCNNNNNNNGG 5 cut(s) 97, 179, 248, 251, 455
BsmAI GTCTC 3 cut(s) 440, 575, 677
BsmFI GGGAC 1 cut(s) 242
BsmI GAATGC 1 cut(s) 530
BsnI GGCC 4 cut(s) 101, 172, 368, 384
Bsp120I GGGCCC 1 cut(s) 382
Bsp1286I GDGCHC 2 cut(s) 283, 386
Bsp1407I TGTACA 1 cut(s) 129
Bsp143I GATC 3 cut(s) 309, 641, 696
BspANI GGCC 4 cut(s) 101, 172, 368, 384
BspCNI CTCAG 5 cut(s) 68, 387, 442, 625, 684
BspLI GGNNCC 5 cut(s) 236, 280, 311, 322, 384
BspPI GGATC 3 cut(s) 304, 317, 704
BspT107I GGYRCC 1 cut(s) 278
BsrFI RCCGGY 1 cut(s) 323
BsrGI TGTACA 1 cut(s) 129
BsrI ACTGG 5 cut(s) 75, 92, 102, 184, 376
BssAI RCCGGY 1 cut(s) 323
BssECI CCNNGG 1 cut(s) 400
BssMI GATC 3 cut(s) 309, 641, 696
Bst2UI CCWGG 2 cut(s) 401, 657
Bst4CI ACNGT 3 cut(s) 292, 421, 434
BstAPI GCANNNNNTGC 1 cut(s) 536
BstAUI TGTACA 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 366
BstDEI CTNAG 6 cut(s) 55, 395, 450, 633, 692, 710
BstENI CCTNNNNNAGG 1 cut(s) 453
BstF5I GGATG 1 cut(s) 261
BstKTI GATC 3 cut(s) 312, 644, 699
BstMAI GTCTC 3 cut(s) 440, 575, 677
BstMBI GATC 3 cut(s) 309, 641, 696
BstMWI GCNNNNNNNGC 5 cut(s) 278, 333, 361, 503, 536
BstNI CCWGG 2 cut(s) 401, 657
BstNSI RCATGY 1 cut(s) 136
BstSCI CCNGG 2 cut(s) 399, 655
BstSLI GKGCMC 2 cut(s) 283, 386
BstV1I GCAGC 3 cut(s) 92, 165, 168
BstX2I RGATCY 1 cut(s) 309
BstYI RGATCY 1 cut(s) 309
BsuRI GGCC 4 cut(s) 101, 172, 368, 384
BtsCI GGATG 1 cut(s) 261
BtsI GCAGTG 1 cut(s) 534
BtsIMutI CAGTG 3 cut(s) 109, 417, 534
Cac8I GCNNGC 1 cut(s) 366
CaiI CAGNNNCTG 1 cut(s) 449
Cfr10I RCCGGY 1 cut(s) 323
Cfr13I GGNCC 4 cut(s) 99, 367, 382, 383
Csp6I GTAC 3 cut(s) 65, 130, 704
CviAII CATG 4 cut(s) 62, 110, 133, 137
CviQI GTAC 3 cut(s) 65, 130, 704
DdeI CTNAG 6 cut(s) 55, 395, 450, 633, 692, 710
DpnI GATC 3 cut(s) 311, 643, 698
DpnII GATC 3 cut(s) 309, 641, 696
DraIII CACNNNGTG 1 cut(s) 251
Eco147I AGGCCT 1 cut(s) 172
Eco24I GRGCYC 1 cut(s) 386
EcoNI CCTNNNNNAGG 1 cut(s) 453
EcoO109I RGGNCCY 1 cut(s) 383
EcoRII CCWGG 2 cut(s) 399, 655
EcoT22I ATGCAT 1 cut(s) 138
EcoT38I GRGCYC 1 cut(s) 386
FaeI CATG 4 cut(s) 65, 113, 136, 140
FaqI GGGAC 1 cut(s) 242
FatI CATG 4 cut(s) 61, 109, 132, 136
Fnu4HI GCNGC 3 cut(s) 81, 154, 157
FokI GGATG 1 cut(s) 248
FriOI GRGCYC 1 cut(s) 386
Fsp4HI GCNGC 3 cut(s) 81, 154, 157
FspBI CTAG 4 cut(s) 168, 188, 455, 621
GluI GCNGC 3 cut(s) 81, 154, 157
HaeIII GGCC 4 cut(s) 101, 172, 368, 384
HapII CCGG 2 cut(s) 324, 333
Hin1II CATG 4 cut(s) 65, 113, 136, 140
HincII GTYRAC 2 cut(s) 88, 662
HindII GTYRAC 2 cut(s) 88, 662
HinfI GANTC 1 cut(s) 685
HpaII CCGG 2 cut(s) 324, 333
HphI GGTGA 4 cut(s) 430, 566, 575, 649
Hpy166II GTNNAC 3 cut(s) 88, 107, 662
Hpy188I TCNGA 1 cut(s) 396
Hpy188III TCNNGA 3 cut(s) 122, 348, 516
Hpy8I GTNNAC 3 cut(s) 88, 107, 662
HpyAV CCTTC 2 cut(s) 248, 542
HpyCH4III ACNGT 3 cut(s) 292, 421, 434
HpyCH4IV ACGT 1 cut(s) 341
HpyCH4V TGCA 4 cut(s) 80, 136, 221, 680
HpyF10VI GCNNNNNNNGC 5 cut(s) 278, 333, 361, 503, 536
HpyF3I CTNAG 6 cut(s) 55, 395, 450, 633, 692, 710
HpySE526I ACGT 1 cut(s) 341
Hsp92II CATG 4 cut(s) 65, 113, 136, 140
Kzo9I GATC 3 cut(s) 309, 641, 696
Lsp1109I GCAGC 3 cut(s) 92, 165, 168
LweI GCATC 1 cut(s) 309
MaeI CTAG 4 cut(s) 168, 188, 455, 621
MaeII ACGT 1 cut(s) 341
MaeIII GTNAC 2 cut(s) 459, 609
MalI GATC 3 cut(s) 311, 643, 698
MboI GATC 3 cut(s) 309, 641, 696
MflI RGATCY 1 cut(s) 309
MhlI GDGCHC 2 cut(s) 283, 386
MluCI AATT 2 cut(s) 11, 117
MlyI GAGTC 1 cut(s) 679
MnlI CCTC 8 cut(s) 64, 197, 293, 324, 545, 628, 663, 687
Mph1103I ATGCAT 1 cut(s) 138
MroXI GAANNNNTTC 1 cut(s) 117
MseI TTAA 1 cut(s) 591
MslI CAYNNNNRTG 1 cut(s) 539
MspI CCGG 2 cut(s) 324, 333
MspR9I CCNGG 2 cut(s) 401, 657
Mva1269I GAATGC 1 cut(s) 530
MvaI CCWGG 2 cut(s) 401, 657
MwoI GCNNNNNNNGC 5 cut(s) 278, 333, 361, 503, 536
NdeII GATC 3 cut(s) 309, 641, 696
NlaIII CATG 4 cut(s) 65, 113, 136, 140
NlaIV GGNNCC 5 cut(s) 236, 280, 311, 322, 384
NmuCI GTSAC 2 cut(s) 459, 609
NsiI ATGCAT 1 cut(s) 138
NspI RCATGY 1 cut(s) 136
PceI AGGCCT 1 cut(s) 172
PctI GAATGC 1 cut(s) 530
PdmI GAANNNNTTC 1 cut(s) 117
PflFI GACNNNGTC 1 cut(s) 92
PflMI CCANNNNNTGG 1 cut(s) 251
PkrI GCNGC 3 cut(s) 82, 155, 158
PleI GAGTC 1 cut(s) 679
PpsI GAGTC 1 cut(s) 679
Psp1406I AACGTT 1 cut(s) 341
Psp6I CCWGG 2 cut(s) 399, 655
PspGI CCWGG 2 cut(s) 399, 655
PspN4I GGNNCC 5 cut(s) 236, 280, 311, 322, 384
PspOMI GGGCCC 1 cut(s) 382
PspPI GGNCC 4 cut(s) 99, 367, 382, 383
PstNI CAGNNNCTG 1 cut(s) 449
PsuI RGATCY 1 cut(s) 309
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 3 cut(s) 66, 131, 705
RsaNI GTAC 3 cut(s) 65, 130, 704
RseI CAYNNNNRTG 1 cut(s) 539
SaqAI TTAA 1 cut(s) 591
SatI GCNGC 3 cut(s) 81, 154, 157
Sau3AI GATC 3 cut(s) 309, 641, 696
Sau96I GGNCC 4 cut(s) 99, 367, 382, 383
SchI GAGTC 1 cut(s) 679
ScrFI CCNGG 2 cut(s) 401, 657
SduI GDGCHC 2 cut(s) 283, 386
SetI ASST 9 cut(s) 169, 208, 253, 344, 451, 456, 556, 639, 716
SfaNI GCATC 1 cut(s) 309
SmiMI CAYNNNNRTG 1 cut(s) 539
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Sse9I AATT 2 cut(s) 11, 117
SseBI AGGCCT 1 cut(s) 172
SspMI CTAG 4 cut(s) 168, 188, 455, 621
StuI AGGCCT 1 cut(s) 172
StyD4I CCNGG 2 cut(s) 399, 655
TaaI ACNGT 3 cut(s) 292, 421, 434
TaiI ACGT 1 cut(s) 344
TasI AATT 2 cut(s) 11, 117
TatI WGTACW 2 cut(s) 64, 129
Tru1I TTAA 1 cut(s) 591
Tru9I TTAA 1 cut(s) 591
TscAI CASTG 3 cut(s) 109, 424, 541
TseFI GTSAC 2 cut(s) 459, 609
TseI GCWGC 3 cut(s) 80, 153, 156
Tsp45I GTSAC 2 cut(s) 459, 609
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 3 cut(s) 109, 424, 541
Tth111I GACNNNGTC 1 cut(s) 92
Van91I CCANNNNNTGG 1 cut(s) 251
XagI CCTNNNNNAGG 1 cut(s) 453
XceI RCATGY 1 cut(s) 136
XmnI GAANNNNTTC 1 cut(s) 117
XspI CTAG 4 cut(s) 168, 188, 455, 621
Zsp2I ATGCAT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.