Rorug05G0303500

zinc finger

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
35365366 .. 35365662
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0303500.1

Sequence Viewer

Length: 297 bp
ATGGCCTCCATTGATGTTATCACCGCTAGCTTTGCTGCCTCCCTTGCGCTTGCAGAGGGAGGTAGTGCTCCTGATCTGGGGAGAATTGGTGGAGGCCCTGTTCGTCGGTCTTCCAAATCTTTTCTGATTGGGAAGCCTCTTACCCGTCGGCCTGTCAACCCTGCGGCCTTCAAGGCTCACTTCCTTCGTATCTGGATGGATGTCACTCTGGTGATGTTAAAGAAGAAGTCGGGCAAGCTACTTGGGAGTAGGAACAAGAATCATCACCCTAGCAAGAAGCCGATGTTGCTACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component

Protein Analysis

98

Amino Acids

10.53

Weight (kDa)

11.66

Isoelectric Point (pI)

43.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 24, 164
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 172
AleI CACNNNNGTG 1 cut(s) 209
AloI GAACNNNNNNTCC 2 cut(s) 84, 116
AluBI AGCT 2 cut(s) 30, 238
AluI AGCT 2 cut(s) 30, 238
Alw21I GWGCWC 1 cut(s) 70
AoxI GGCC 4 cut(s) 3, 94, 149, 165
ApeKI GCWGC 1 cut(s) 35
AspLEI GCGC 1 cut(s) 49
AspS9I GGNCC 1 cut(s) 95
AsuHPI GGTGA 3 cut(s) 13, 223, 257
AsuNHI GCTAGC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 102
Bbv12I GWGCWC 1 cut(s) 70
BbvI GCAGC 1 cut(s) 22
BccI CCATC 1 cut(s) 190
BfaI CTAG 2 cut(s) 27, 270
BglI GCCNNNNNGGC 1 cut(s) 173
BisI GCNGC 2 cut(s) 36, 165
BlsI GCNGC 2 cut(s) 37, 166
BmgT120I GGNCC 1 cut(s) 95
BmtI GCTAGC 1 cut(s) 30
BpiI GAAGAC 1 cut(s) 102
BsaXI ACNNNNNCTCC 4 cut(s) 73, 84, 103, 114
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseGI GGATG 2 cut(s) 201, 205
BseLI CCNNNNNNNGG 1 cut(s) 77
BseXI GCAGC 1 cut(s) 22
BshFI GGCC 4 cut(s) 5, 96, 151, 167
BsiHKAI GWGCWC 1 cut(s) 70
BslI CCNNNNNNNGG 1 cut(s) 77
BsnI GGCC 4 cut(s) 5, 96, 151, 167
Bsp1286I GDGCHC 1 cut(s) 70
Bsp143I GATC 1 cut(s) 73
BspACI CCGC 2 cut(s) 24, 164
BspANI GGCC 4 cut(s) 5, 96, 151, 167
BspOI GCTAGC 1 cut(s) 30
BssMI GATC 1 cut(s) 73
BstC8I GCNNGC 3 cut(s) 28, 51, 236
BstF5I GGATG 2 cut(s) 201, 205
BstHHI GCGC 1 cut(s) 49
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 4 cut(s) 32, 44, 173, 286
BstV1I GCAGC 1 cut(s) 22
BstV2I GAAGAC 1 cut(s) 102
BsuRI GGCC 4 cut(s) 5, 96, 151, 167
BtsCI GGATG 2 cut(s) 201, 205
Cac8I GCNNGC 3 cut(s) 28, 51, 236
CfoI GCGC 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 95
CviJI RGCY 9 cut(s) 5, 30, 96, 136, 151, 167, 176, 238, 280
CviKI_1 RGCY 9 cut(s) 5, 30, 96, 136, 151, 167, 176, 238, 280
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
EcoO109I RGGNCCY 1 cut(s) 95
FalI AAGNNNNNCTT 2 cut(s) 164, 196
Fnu4HI GCNGC 2 cut(s) 36, 165
FokI GGATG 2 cut(s) 208, 212
Fsp4HI GCNGC 2 cut(s) 36, 165
FspBI CTAG 2 cut(s) 27, 270
GlaI GCGC 1 cut(s) 48
GluI GCNGC 2 cut(s) 36, 165
HaeIII GGCC 4 cut(s) 5, 96, 151, 167
HhaI GCGC 1 cut(s) 49
Hin6I GCGC 1 cut(s) 47
HinP1I GCGC 1 cut(s) 47
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HinfI GANTC 1 cut(s) 259
HphI GGTGA 3 cut(s) 13, 223, 257
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 2 cut(s) 71, 193
Hpy8I GTNNAC 1 cut(s) 157
Hpy99I CGWCG 2 cut(s) 108, 150
HpyAV CCTTC 2 cut(s) 178, 194
HpyCH4V TGCA 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 4 cut(s) 32, 44, 173, 286
HspAI GCGC 1 cut(s) 47
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 7 cut(s) 62, 84, 111, 165, 174, 178, 194
Lsp1109I GCAGC 1 cut(s) 22
MaeI CTAG 2 cut(s) 27, 270
MaeIII GTNAC 1 cut(s) 202
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 2 cut(s) 102, 235
MhlI GDGCHC 1 cut(s) 70
MluCI AATT 1 cut(s) 84
MnlI CCTC 6 cut(s) 16, 49, 49, 53, 86, 147
MseI TTAA 1 cut(s) 218
MslI CAYNNNNRTG 1 cut(s) 209
MwoI GCNNNNNNNGC 4 cut(s) 32, 44, 173, 286
NdeII GATC 1 cut(s) 73
NheI GCTAGC 1 cut(s) 26
NmuCI GTSAC 1 cut(s) 202
OliI CACNNNNGTG 1 cut(s) 209
PfeI GAWTC 1 cut(s) 259
PkrI GCNGC 2 cut(s) 37, 166
PspPI GGNCC 1 cut(s) 95
RseI CAYNNNNRTG 1 cut(s) 209
SaqAI TTAA 1 cut(s) 218
SatI GCNGC 2 cut(s) 36, 165
Sau3AI GATC 1 cut(s) 73
Sau96I GGNCC 1 cut(s) 95
SduI GDGCHC 1 cut(s) 70
SetI ASST 3 cut(s) 32, 64, 240
SmiMI CAYNNNNRTG 1 cut(s) 209
Sse9I AATT 1 cut(s) 84
SsiI CCGC 2 cut(s) 24, 164
SspMI CTAG 2 cut(s) 27, 270
TaqII GACCGA 1 cut(s) 96
TasI AATT 1 cut(s) 84
TauI GCSGC 1 cut(s) 167
TfiI GAWTC 1 cut(s) 259
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TseFI GTSAC 1 cut(s) 202
TseI GCWGC 1 cut(s) 35
Tsp45I GTSAC 1 cut(s) 202
XspI CTAG 2 cut(s) 27, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.