Rorug07G0222700

Belongs to the ClpA ClpB family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
20163300 .. 20163545
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0222700.1

Sequence Viewer

Length: 246 bp
ATGGATCTATACATCCTCCCTGGCATATCAAAAGCATCCTCAAAGACATTTTATGGTTGTCATCTCAACTCCACAGCTTCAGCCTTAAACATGTCAAGAGAGAAGCCAACTTCAGCCAATGCAATTGCCAATACGGGACACCATCCTACTGCTCAAGTTTGGAAAAATTCTCTGCCATTATCTACTTGTAATGCTCACTTGTTTGATAGTATGGGTATAGATTGTACTAGGGGTTCTGCTCGTTAG

Protein Analysis

81

Amino Acids

8.67

Weight (kDa)

8.99

Isoelectric Point (pI)

35.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 166
AcuI CTGAAG 2 cut(s) 63, 96
AfaI GTAC 1 cut(s) 226
AflIII ACRYGT 1 cut(s) 90
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 166
BccI CCATC 1 cut(s) 150
BciT130I CCWGG 1 cut(s) 21
BfaI CTAG 1 cut(s) 228
Bme1390I CCNGG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 44
BpuEI CTTGAG 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 19
BseBI CCWGG 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 19
BseGI GGATG 3 cut(s) 12, 35, 142
BslFI GGGAC 1 cut(s) 150
BsmFI GGGAC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 4
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 19
BssMI GATC 1 cut(s) 4
Bst2UI CCWGG 1 cut(s) 21
BstF5I GGATG 3 cut(s) 12, 35, 142
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstNI CCWGG 1 cut(s) 21
BstNSI RCATGY 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 19
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtsCI GGATG 3 cut(s) 12, 35, 142
Csp6I GTAC 1 cut(s) 225
CviAII CATG 1 cut(s) 91
CviJI RGCY 4 cut(s) 77, 83, 106, 116
CviKI_1 RGCY 4 cut(s) 77, 83, 106, 116
CviQI GTAC 1 cut(s) 225
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eco57I CTGAAG 2 cut(s) 63, 96
EcoRII CCWGG 1 cut(s) 19
FaeI CATG 1 cut(s) 94
FaiI YATR 6 cut(s) 10, 26, 54, 92, 212, 218
FaqI GGGAC 1 cut(s) 150
FatI CATG 1 cut(s) 90
FokI GGATG 2 cut(s) 22, 129
FspBI CTAG 1 cut(s) 228
Hin1II CATG 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 122
Hsp92II CATG 1 cut(s) 94
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 6, 33
LweI GCATC 1 cut(s) 44
MaeI CTAG 1 cut(s) 228
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MfeI CAATTG 1 cut(s) 123
MflI RGATCY 1 cut(s) 4
MluCI AATT 2 cut(s) 123, 166
MnlI CCTC 2 cut(s) 26, 49
MseI TTAA 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 21
MunI CAATTG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 21
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 94
NspI RCATGY 1 cut(s) 94
PciI ACATGT 1 cut(s) 90
PscI ACATGT 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PsrI GAACNNNNNNTAC 1 cut(s) 217
PsuI RGATCY 1 cut(s) 4
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 21
SetI ASST 1 cut(s) 79
SfaNI GCATC 1 cut(s) 44
SgeI CNNG 9 cut(s) 32, 33, 103, 108, 147, 167, 198, 211, 240
SmlI CTYRAG 1 cut(s) 153
SmoI CTYRAG 1 cut(s) 153
Sse9I AATT 2 cut(s) 123, 166
SspMI CTAG 1 cut(s) 228
StyD4I CCNGG 1 cut(s) 19
TasI AATT 2 cut(s) 123, 166
TatI WGTACW 1 cut(s) 224
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XapI RAATTY 1 cut(s) 166
XceI RCATGY 1 cut(s) 94
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.