Rh1AG310200

AP2-like ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
54426352 .. 54426928
577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG310200.1

Sequence Viewer

Length: 273 bp
ATGGCCAGGGATCAGCTTGCTTGCGCCGAGTTTACAGGTCACTCGGTTGAGTCAGATGGGAACGAGTTGGGTTTCTCAAGCTGTGGTGCTACGAACAAAAGCAATACTTTGTCTCTTGGGTTACTAATGCTAATACTCAGACCTCGAATCGTGAAAAAGGCCATTGTTGCGGTGGACATTGATAGCACTAAGAAAATCTCTGATACTTTTGAGCAGAGGACTTCAGTGGAGTTACTAGACATCGTTGGACGGGTAGATATGAAGCGCATCTAA

Protein Analysis

90

Amino Acids

9.83

Weight (kDa)

6.55

Isoelectric Point (pI)

26.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 170
AclWI GGATC 1 cut(s) 18
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 207
AjnI CCWGG 1 cut(s) 5
AluBI AGCT 2 cut(s) 16, 81
AluI AGCT 2 cut(s) 16, 81
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 18
AoxI GGCC 2 cut(s) 3, 159
AspLEI GCGC 2 cut(s) 26, 267
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 1 cut(s) 236
Bme1390I CCNGG 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 7
BpuEI CTTGAG 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 6
BseBI CCWGG 1 cut(s) 7
BseDI CCNNGG 1 cut(s) 6
BseMII CTCAG 1 cut(s) 151
BshFI GGCC 2 cut(s) 5, 161
BsmAI GTCTC 1 cut(s) 117
BsnI GGCC 2 cut(s) 5, 161
Bsp143I GATC 1 cut(s) 10
BspACI CCGC 1 cut(s) 170
BspANI GGCC 2 cut(s) 5, 161
BspCNI CTCAG 1 cut(s) 150
BspPI GGATC 1 cut(s) 18
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 7
BstC8I GCNNGC 2 cut(s) 18, 22
BstDEI CTNAG 2 cut(s) 137, 189
BstHHI GCGC 2 cut(s) 26, 267
BstKTI GATC 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNI CCWGG 1 cut(s) 7
BstSCI CCNGG 1 cut(s) 5
BsuRI GGCC 2 cut(s) 5, 161
BtsIMutI CAGTG 1 cut(s) 231
Cac8I GCNNGC 2 cut(s) 18, 22
CfoI GCGC 2 cut(s) 26, 267
CviJI RGCY 4 cut(s) 5, 16, 81, 161
CviKI_1 RGCY 4 cut(s) 5, 16, 81, 161
DdeI CTNAG 2 cut(s) 137, 189
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
EaeI YGGCCR 1 cut(s) 3
Eco57I CTGAAG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 5
FaiI YATR 1 cut(s) 260
FalI AAGNNNNNCTT 2 cut(s) 91, 123
FspBI CTAG 1 cut(s) 236
GlaI GCGC 2 cut(s) 25, 266
HaeIII GGCC 2 cut(s) 5, 161
HhaI GCGC 2 cut(s) 26, 267
Hin6I GCGC 2 cut(s) 24, 265
HinP1I GCGC 2 cut(s) 24, 265
HinfI GANTC 2 cut(s) 50, 147
Hpy166II GTNNAC 2 cut(s) 33, 175
Hpy188I TCNGA 3 cut(s) 55, 140, 202
Hpy188III TCNNGA 1 cut(s) 151
Hpy8I GTNNAC 2 cut(s) 33, 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 2 cut(s) 137, 189
HspAI GCGC 2 cut(s) 24, 265
Kzo9I GATC 1 cut(s) 10
LpnPI CCDG 2 cut(s) 19, 21
MaeI CTAG 1 cut(s) 236
MaeIII GTNAC 3 cut(s) 38, 120, 231
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 2 cut(s) 153, 210
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 7
MvaI CCWGG 1 cut(s) 7
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 1 cut(s) 10
NmeAIII GCCGAG 1 cut(s) 52
NmuCI GTSAC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 147
PleI GAGTC 1 cut(s) 58
PpsI GAGTC 1 cut(s) 58
Psp6I CCWGG 1 cut(s) 5
PspGI CCWGG 1 cut(s) 5
Sau3AI GATC 1 cut(s) 10
SchI GAGTC 1 cut(s) 59
ScrFI CCNGG 1 cut(s) 7
SetI ASST 4 cut(s) 18, 40, 83, 145
SmlI CTYRAG 1 cut(s) 76
SmoI CTYRAG 1 cut(s) 76
SsiI CCGC 1 cut(s) 170
SspMI CTAG 1 cut(s) 236
StyD4I CCNGG 1 cut(s) 5
TaqI TCGA 1 cut(s) 145
TfiI GAWTC 1 cut(s) 147
TscAI CASTG 1 cut(s) 231
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
TspRI CASTG 1 cut(s) 231
XcmI CCANNNNNNNNNTGG 1 cut(s) 169
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.