Rh1BG395200

Protein of unknown function (DUF3143)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0010374
Physical Location & Seq
Forward (+)
51997340 .. 51999034
1695 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG395200.1

Sequence Viewer

Length: 219 bp
ATGCGGAGTAGCTTGGGGTTTTTCCAGAGCAGAGAGGACCGGGCCGTTTGGCTGATCGAAAAGCCCGAGTGGCATGCCCAGCTCTCTCTCGACGTTACCGATCTCTATGTCAGGTATCTGAAGACCGGACCTGGAAATCTTGAAAAGGATATGGAGAGGAGGTTTAGCTATGCACTGAGCAGAGAGGACATCGAAAATGCAGTGCTTGGAGGTCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3143

Protein Analysis

72

Amino Acids

8.39

Weight (kDa)

5.28

Isoelectric Point (pI)

57.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3143 PF11341 5 - 71 1.7e-24 Protein of unknown function (DUF3143)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AcuI CTGAAG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 143
AjnI CCWGG 1 cut(s) 130
AluBI AGCT 3 cut(s) 12, 82, 168
AluI AGCT 3 cut(s) 12, 82, 168
Ama87I CYCGRG 1 cut(s) 65
AoxI GGCC 1 cut(s) 42
AspS9I GGNCC 4 cut(s) 37, 42, 128, 212
AsuC2I CCSGG 1 cut(s) 41
AvaI CYCGRG 1 cut(s) 65
AvaII GGWCC 3 cut(s) 37, 128, 212
BbsI GAAGAC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 29
BcgI CGANNNNNNTGC 2 cut(s) 56, 90
BciT130I CCWGG 1 cut(s) 132
BcnI CCSGG 1 cut(s) 41
BglI GCCNNNNNGGC 1 cut(s) 70
Bme1390I CCNGG 2 cut(s) 41, 132
Bme18I GGWCC 3 cut(s) 37, 128, 212
BmeT110I CYCGRG 1 cut(s) 65
BmgT120I GGNCC 4 cut(s) 37, 42, 128, 212
BmiI GGNNCC 1 cut(s) 214
BmrFI CCNGG 2 cut(s) 41, 132
BpiI GAAGAC 1 cut(s) 128
BpuMI CCSGG 1 cut(s) 41
BsaWI WCCGGW 1 cut(s) 125
BsaXI ACNNNNNCTCC 2 cut(s) 146, 176
BseBI CCWGG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 167
BseRI GAGGAG 1 cut(s) 172
BseYI CCCAGC 1 cut(s) 78
BshFI GGCC 1 cut(s) 44
BsiHKCI CYCGRG 1 cut(s) 65
BsiSI CCGG 2 cut(s) 40, 126
BslFI GGGAC 1 cut(s) 198
BsmFI GGGAC 1 cut(s) 198
BsnI GGCC 1 cut(s) 44
BsoBI CYCGRG 1 cut(s) 65
Bsp143I GATC 2 cut(s) 54, 100
BspACI CCGC 1 cut(s) 4
BspANI GGCC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 214
BssMI GATC 2 cut(s) 54, 100
Bst2UI CCWGG 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 176
BstKTI GATC 2 cut(s) 57, 103
BstMBI GATC 2 cut(s) 54, 100
BstMWI GCNNNNNNNGC 2 cut(s) 70, 79
BstNI CCWGG 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 77
BstSCI CCNGG 2 cut(s) 39, 130
BstV2I GAAGAC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 44
BtsI GCAGTG 1 cut(s) 207
BtsIMutI CAGTG 2 cut(s) 173, 207
Cac8I GCNNGC 1 cut(s) 75
Cfr13I GGNCC 4 cut(s) 37, 42, 128, 212
CviAII CATG 1 cut(s) 74
CviJI RGCY 6 cut(s) 12, 44, 52, 64, 82, 168
CviKI_1 RGCY 6 cut(s) 12, 44, 52, 64, 82, 168
DdeI CTNAG 1 cut(s) 176
DpnI GATC 2 cut(s) 56, 102
DpnII GATC 2 cut(s) 54, 100
Eco47I GGWCC 3 cut(s) 37, 128, 212
Eco57I CTGAAG 1 cut(s) 140
Eco88I CYCGRG 1 cut(s) 65
EcoO109I RGGNCCY 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 130
FaeI CATG 1 cut(s) 77
FaiI YATR 4 cut(s) 75, 108, 152, 171
FaqI GGGAC 1 cut(s) 198
FatI CATG 1 cut(s) 73
GsaI CCCAGC 1 cut(s) 82
HaeIII GGCC 1 cut(s) 44
HapII CCGG 2 cut(s) 40, 126
Hin1II CATG 1 cut(s) 77
HpaII CCGG 2 cut(s) 40, 126
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 3 cut(s) 25, 89, 140
Hpy99I CGWCG 1 cut(s) 95
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 2 cut(s) 173, 200
HpyF10VI GCNNNNNNNGC 2 cut(s) 70, 79
HpyF3I CTNAG 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 1 cut(s) 77
Kzo9I GATC 2 cut(s) 54, 100
LpnPI CCDG 7 cut(s) 38, 53, 92, 97, 117, 139, 144
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 94
MalI GATC 2 cut(s) 56, 102
MboI GATC 2 cut(s) 54, 100
MboII GAAGA 1 cut(s) 133
MnlI CCTC 5 cut(s) 28, 150, 153, 178, 203
MspI CCGG 2 cut(s) 40, 126
MspR9I CCNGG 2 cut(s) 41, 132
MvaI CCWGG 1 cut(s) 132
MwoI GCNNNNNNNGC 2 cut(s) 70, 79
NciI CCSGG 1 cut(s) 41
NdeII GATC 2 cut(s) 54, 100
NlaIII CATG 1 cut(s) 77
NlaIV GGNNCC 1 cut(s) 214
NspI RCATGY 1 cut(s) 77
PaeI GCATGC 1 cut(s) 77
PcsI WCGNNNNNNNCGW 2 cut(s) 63, 96
PpuMI RGGWCCY 1 cut(s) 212
Psp5II RGGWCCY 1 cut(s) 212
Psp6I CCWGG 1 cut(s) 130
PspFI CCCAGC 1 cut(s) 78
PspGI CCWGG 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 214
PspPI GGNCC 4 cut(s) 37, 42, 128, 212
PspPPI RGGWCCY 1 cut(s) 212
Sau3AI GATC 2 cut(s) 54, 100
Sau96I GGNCC 4 cut(s) 37, 42, 128, 212
ScrFI CCNGG 2 cut(s) 41, 132
SetI ASST 8 cut(s) 14, 84, 96, 116, 133, 164, 170, 214
SinI GGWCC 3 cut(s) 37, 128, 212
SphI GCATGC 1 cut(s) 77
SsiI CCGC 1 cut(s) 4
StyD4I CCNGG 2 cut(s) 39, 130
TaiI ACGT 1 cut(s) 96
TaqI TCGA 3 cut(s) 57, 90, 192
TscAI CASTG 2 cut(s) 180, 207
TspRI CASTG 2 cut(s) 180, 207
VpaK11BI GGWCC 3 cut(s) 37, 128, 212
XceI RCATGY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.