Rh2AG467000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0012700
Physical Location & Seq
Reverse (-)
68745070 .. 68745309
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG467000.1

Sequence Viewer

Length: 240 bp
ATGGCTAACGCCATAGATGACTTTATTGTTGCTTTCGCGCTCTCCGTTGTGTCTCGTGCCGAAGTAGGGTGCGTTGGAAGTGTTGCGAGGCAGGACGACATTCGCTTCTTGATGGGGCGTTGTGCTCTGCCTTTTCTTTTTCTGATACTTGTTGTGCTCAGCCTCGGTAGAGATGGGACTGATCCGAGCTTGGATCTGGTTCAAACTTGTCTAGCGAGTGAGACGGGCGATACAACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.38

Weight (kDa)

4.16

Isoelectric Point (pI)

24.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 38
AclWI GGATC 2 cut(s) 176, 201
AfiI CCNNNNNNNGG 1 cut(s) 66
AgsI TTSAA 1 cut(s) 203
AluBI AGCT 1 cut(s) 189
AluI AGCT 1 cut(s) 189
Alw21I GWGCWC 2 cut(s) 127, 159
Alw26I GTCTC 2 cut(s) 57, 215
AlwI GGATC 2 cut(s) 176, 201
AspLEI GCGC 1 cut(s) 40
BauI CACGAG 1 cut(s) 54
Bbv12I GWGCWC 2 cut(s) 127, 159
BccI CCATC 2 cut(s) 106, 167
BcoDI GTCTC 2 cut(s) 57, 215
BfaI CTAG 1 cut(s) 212
BlpI GCTNAGC 1 cut(s) 158
Bpu1102I GCTNAGC 1 cut(s) 158
BsaJI CCNNGG 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 172
Bsh1236I CGCG 1 cut(s) 38
BsiHKAI GWGCWC 2 cut(s) 127, 159
BslFI GGGAC 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 66
BsmAI GTCTC 2 cut(s) 57, 215
BsmBI CGTCTC 1 cut(s) 215
BsmFI GGGAC 1 cut(s) 190
Bsp1286I GDGCHC 2 cut(s) 127, 159
Bsp143I GATC 2 cut(s) 181, 193
Bsp1720I GCTNAGC 1 cut(s) 158
BspCNI CTCAG 1 cut(s) 171
BspFNI CGCG 1 cut(s) 38
BspPI GGATC 2 cut(s) 176, 201
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 2 cut(s) 181, 193
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 158
BstFNI CGCG 1 cut(s) 38
BstHHI GCGC 1 cut(s) 40
BstKTI GATC 2 cut(s) 184, 196
BstMAI GTCTC 2 cut(s) 57, 215
BstMBI GATC 2 cut(s) 181, 193
BstUI CGCG 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 193
BstYI RGATCY 1 cut(s) 193
CfoI GCGC 1 cut(s) 40
CviJI RGCY 3 cut(s) 5, 162, 189
CviKI_1 RGCY 3 cut(s) 5, 162, 189
DdeI CTNAG 1 cut(s) 158
DpnI GATC 2 cut(s) 183, 195
DpnII GATC 2 cut(s) 181, 193
Esp3I CGTCTC 1 cut(s) 215
FaiI YATR 1 cut(s) 14
FaqI GGGAC 1 cut(s) 190
FspBI CTAG 1 cut(s) 212
GlaI GCGC 1 cut(s) 39
HhaI GCGC 1 cut(s) 40
Hin6I GCGC 1 cut(s) 38
HinP1I GCGC 1 cut(s) 38
Hpy188I TCNGA 2 cut(s) 144, 186
Hpy188III TCNNGA 1 cut(s) 109
HpyF3I CTNAG 1 cut(s) 158
HspAI GCGC 1 cut(s) 38
Kzo9I GATC 2 cut(s) 181, 193
LpnPI CCDG 2 cut(s) 77, 182
MaeI CTAG 1 cut(s) 212
MalI GATC 2 cut(s) 183, 195
MboI GATC 2 cut(s) 181, 193
MflI RGATCY 1 cut(s) 193
MhlI GDGCHC 2 cut(s) 127, 159
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 2 cut(s) 81, 173
MvnI CGCG 1 cut(s) 38
NdeII GATC 2 cut(s) 181, 193
PcsI WCGNNNNNNNCGW 1 cut(s) 42
PsuI RGATCY 1 cut(s) 193
Sau3AI GATC 2 cut(s) 181, 193
SduI GDGCHC 2 cut(s) 127, 159
SetI ASST 2 cut(s) 191, 239
SspMI CTAG 1 cut(s) 212
TspGWI ACGGA 1 cut(s) 34
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.