Rh2BG317000

Frigida-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
37625024 .. 37627538
2515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG317000.1

Sequence Viewer

Length: 420 bp
ATGCAAGTTGAAAAGCAAGGCAAAGAGCATGAATTGTGGTCAAAACATTCTGATTCTGGATTGAATACTGAGCTGTTGGAACTTACTCATGCTGCTGATGATATGATTATTCCTCAATCTGTAAGTGATCAACCCAACATAATTACGGATGGTAGAAGCTTTGAGGTGATCCCTGTACCACTCTTGAAAGAATTTGTGGAGGATGCAAAGAAGTCTTGCACTGGAATTTTCAGTAAAGAGATATCACATGATGTAAAGGAAAAGGTTGTAGATGACCTAATAGCTTATCTAAAAGCTGTGGTTCAGTGCATTGAAGATCACAGCCTCCAGTCGCAGTACCCACCAACTGACATTATGATGGAAATTCAAGGGCTTGGGGAACTCTCCGAAGCTGCTGCTATCTCTTCCGTCCAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.41

Weight (kDa)

4.53

Isoelectric Point (pI)

45.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Frigida PF07899 55 - 126 1.2e-10 Frigida-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 163
AcsI RAATTY 3 cut(s) 191, 225, 363
AfaI GTAC 2 cut(s) 177, 338
AgsI TTSAA 5 cut(s) 11, 64, 187, 314, 368
AluBI AGCT 5 cut(s) 73, 159, 284, 296, 392
AluI AGCT 5 cut(s) 73, 159, 284, 296, 392
AlwI GGATC 1 cut(s) 163
ApeKI GCWGC 3 cut(s) 92, 392, 395
ApoI RAATTY 3 cut(s) 191, 225, 363
AsuHPI GGTGA 1 cut(s) 178
BbvI GCAGC 3 cut(s) 79, 379, 382
BccI CCATC 2 cut(s) 143, 352
BcgI CGANNNNNNTGC 2 cut(s) 377, 411
BclI TGATCA 1 cut(s) 127
BisI GCNGC 3 cut(s) 93, 393, 396
BlsI GCNGC 3 cut(s) 94, 394, 397
BmsI GCATC 1 cut(s) 193
BpmI CTGGAG 1 cut(s) 311
Bse1I ACTGG 2 cut(s) 226, 328
BseGI GGATG 2 cut(s) 154, 208
BseMII CTCAG 1 cut(s) 60
BseNI ACTGG 2 cut(s) 226, 328
BseXI GCAGC 3 cut(s) 79, 379, 382
Bsp143I GATC 3 cut(s) 127, 168, 316
BspCNI CTCAG 1 cut(s) 61
BspPI GGATC 1 cut(s) 163
BsrI ACTGG 2 cut(s) 226, 328
BssMI GATC 3 cut(s) 127, 168, 316
Bst6I CTCTTC 1 cut(s) 409
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 2 cut(s) 154, 208
BstKTI GATC 3 cut(s) 130, 171, 319
BstMBI GATC 3 cut(s) 127, 168, 316
BstV1I GCAGC 3 cut(s) 79, 379, 382
BtsCI GGATG 2 cut(s) 154, 208
BtsIMutI CAGTG 2 cut(s) 219, 311
Csp6I GTAC 2 cut(s) 176, 337
CviAII CATG 3 cut(s) 29, 89, 248
CviJI RGCY 7 cut(s) 73, 159, 284, 296, 324, 373, 392
CviKI_1 RGCY 7 cut(s) 73, 159, 284, 296, 324, 373, 392
CviQI GTAC 2 cut(s) 176, 337
DdeI CTNAG 1 cut(s) 69
DpnI GATC 3 cut(s) 129, 170, 318
DpnII GATC 3 cut(s) 127, 168, 316
Eam1104I CTCTTC 1 cut(s) 409
EarI CTCTTC 1 cut(s) 409
Eco32I GATATC 1 cut(s) 243
EcoRV GATATC 1 cut(s) 243
FaeI CATG 3 cut(s) 32, 92, 251
FaiI YATR 6 cut(s) 30, 90, 104, 140, 249, 356
FatI CATG 3 cut(s) 28, 88, 247
FbaI TGATCA 1 cut(s) 127
Fnu4HI GCNGC 3 cut(s) 93, 393, 396
FokI GGATG 2 cut(s) 161, 215
Fsp4HI GCNGC 3 cut(s) 93, 393, 396
GluI GCNGC 3 cut(s) 93, 393, 396
GsuI CTGGAG 1 cut(s) 311
Hin1II CATG 3 cut(s) 32, 92, 251
HindIII AAGCTT 1 cut(s) 157
HinfI GANTC 1 cut(s) 53
HphI GGTGA 1 cut(s) 178
Hpy188I TCNGA 2 cut(s) 52, 388
Hpy188III TCNNGA 2 cut(s) 57, 184
HpyCH4V TGCA 4 cut(s) 4, 206, 219, 309
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 3 cut(s) 32, 92, 251
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 3 cut(s) 127, 168, 316
LpnPI CCDG 4 cut(s) 42, 186, 207, 341
Lsp1109I GCAGC 3 cut(s) 79, 379, 382
LweI GCATC 1 cut(s) 193
MalI GATC 3 cut(s) 129, 170, 318
MboI GATC 3 cut(s) 127, 168, 316
MboII GAAGA 2 cut(s) 326, 396
MluCI AATT 5 cut(s) 32, 141, 191, 225, 363
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 4 cut(s) 123, 157, 193, 335
MslI CAYNNNNRTG 1 cut(s) 356
NdeII GATC 3 cut(s) 127, 168, 316
NlaIII CATG 3 cut(s) 32, 92, 251
PfeI GAWTC 1 cut(s) 53
PkrI GCNGC 3 cut(s) 94, 394, 397
RsaI GTAC 2 cut(s) 177, 338
RsaNI GTAC 2 cut(s) 176, 337
RseI CAYNNNNRTG 1 cut(s) 356
SatI GCNGC 3 cut(s) 93, 393, 396
Sau3AI GATC 3 cut(s) 127, 168, 316
SetI ASST 8 cut(s) 75, 161, 168, 267, 279, 286, 298, 394
SfaNI GCATC 1 cut(s) 193
SmiMI CAYNNNNRTG 1 cut(s) 356
Sse9I AATT 5 cut(s) 32, 141, 191, 225, 363
TasI AATT 5 cut(s) 32, 141, 191, 225, 363
TfiI GAWTC 1 cut(s) 53
TscAI CASTG 2 cut(s) 226, 311
TseI GCWGC 3 cut(s) 92, 392, 395
TspDTI ATGAA 1 cut(s) 45
TspGWI ACGGA 2 cut(s) 161, 397
TspRI CASTG 2 cut(s) 226, 311
XapI RAATTY 3 cut(s) 191, 225, 363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.