Rh2CG295100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
33867627 .. 33867908
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG295100.1

Sequence Viewer

Length: 282 bp
ATGAAAATACTAGTCAGAGAGAAGGGGAAGGGGTGTGAGTTGATCGAAAATCGGGTTTTGGAGTCCTCACCACAGAGATCGTATTATTTTGGGAGATGTGTAGAAAAGAGGAGGAAGGAGTTTGAGGCTAAGGAAAAAGAACTGAAGGAGGTTCAGGGGTGTATTGAGTTGAACGAGAGGCAATTAGACGGGATTTTGAAGTCGATTCAGGAGCACACGAAAGAATGTGACTTGAAAGGAAAGCAAGTTAAGGCATTGCAGAGGTCCATTGACAAAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.96

Weight (kDa)

9.1

Isoelectric Point (pI)

61.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 164
AgsI TTSAA 3 cut(s) 172, 199, 235
AhlI ACTAGT 1 cut(s) 10
Alw21I GWGCWC 1 cut(s) 216
AspS9I GGNCC 1 cut(s) 264
AsuHPI GGTGA 1 cut(s) 60
AvaII GGWCC 1 cut(s) 264
Bbv12I GWGCWC 1 cut(s) 216
BcuI ACTAGT 1 cut(s) 10
BfaI CTAG 1 cut(s) 11
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 1 cut(s) 264
Bpu10I CCTNAGC 1 cut(s) 129
Bse3DI GCAATG 1 cut(s) 254
BseMI GCAATG 1 cut(s) 254
BseRI GAGGAG 1 cut(s) 124
BsiHKAI GWGCWC 1 cut(s) 216
Bsp1286I GDGCHC 1 cut(s) 216
Bsp143I GATC 2 cut(s) 42, 77
BsrDI GCAATG 1 cut(s) 254
BssMI GATC 2 cut(s) 42, 77
BstDEI CTNAG 1 cut(s) 129
BstKTI GATC 2 cut(s) 45, 80
BstMBI GATC 2 cut(s) 42, 77
Cfr13I GGNCC 1 cut(s) 264
CviJI RGCY 1 cut(s) 128
CviKI_1 RGCY 1 cut(s) 128
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 44, 79
DpnII GATC 2 cut(s) 42, 77
Eco47I GGWCC 1 cut(s) 264
Eco57I CTGAAG 1 cut(s) 164
FspBI CTAG 1 cut(s) 11
HinfI GANTC 2 cut(s) 62, 205
HphI GGTGA 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 209
HpyAV CCTTC 4 cut(s) 16, 22, 109, 139
HpyCH4V TGCA 1 cut(s) 259
HpyF3I CTNAG 1 cut(s) 129
Kzo9I GATC 2 cut(s) 42, 77
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 2 cut(s) 140, 194
MaeI CTAG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 227
MalI GATC 2 cut(s) 44, 79
MboI GATC 2 cut(s) 42, 77
MhlI GDGCHC 1 cut(s) 216
MluCI AATT 1 cut(s) 182
MlyI GAGTC 1 cut(s) 71
MnlI CCTC 7 cut(s) 76, 102, 105, 118, 142, 171, 255
MseI TTAA 1 cut(s) 249
NdeII GATC 2 cut(s) 42, 77
NmuCI GTSAC 1 cut(s) 227
PfeI GAWTC 1 cut(s) 205
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
PspPI GGNCC 1 cut(s) 264
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 2 cut(s) 42, 77
Sau96I GGNCC 1 cut(s) 264
SchI GAGTC 1 cut(s) 71
SduI GDGCHC 1 cut(s) 216
SetI ASST 2 cut(s) 153, 266
SgeI CNNG 9 cut(s) 23, 65, 167, 187, 202, 221, 229, 244, 257
SinI GGWCC 1 cut(s) 264
SpeI ACTAGT 1 cut(s) 10
Sse9I AATT 1 cut(s) 182
SspMI CTAG 1 cut(s) 11
TaqI TCGA 2 cut(s) 45, 203
TasI AATT 1 cut(s) 182
TfiI GAWTC 1 cut(s) 205
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TseFI GTSAC 1 cut(s) 227
Tsp45I GTSAC 1 cut(s) 227
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 264
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.