Rh2CG467200

Belongs to the peptidase S10 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
63056649 .. 63061517
4869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG467200.1

Sequence Viewer

Length: 453 bp
ATGGATTTGCTGGTTGGAGTCGGTGAGGCATCTTTGATAAGTCTTGCAGCTCCGTTCATTGATGACCATGCCCCTGCAGATCAGGCATCTAATCTGTTGTATGTTGACCAGCCTATTGGTACTAGATTCAATTATAGTTTTGATAGAAGTGATATTTATCACTCTGAAGATGGTGTTAGTAACAACCTCTCTGACTTCTTACAGGTGTGTCATTTAAAGGATGTAATTGATCAAATCATTAAGTTTTTTCGGAGTAATACAGCTAGTCAGAAGATAGCTATGGATACTGCAACTGCTACGCAGTGTAAAGGTTGGAGCAGCTCAAGTCAAGTAAGCTCAGAGATCATTCTGAAAAAGCAGTTGGAACTGGAGGACAATCTGTTGGATGCTCCACCAGACACACTAGGTGCTGCTGCCTTGGCACTACACTATGCAAGTGTGGGAGAATGTTAG

Protein Analysis

150

Amino Acids

16.27

Weight (kDa)

4.38

Isoelectric Point (pI)

41.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 186
AdeI CACNNNGTG 1 cut(s) 407
AfaI GTAC 1 cut(s) 121
AgsI TTSAA 1 cut(s) 130
AjuI GAANNNNNNNTTGG 2 cut(s) 344, 376
AluBI AGCT 5 cut(s) 50, 263, 278, 321, 336
AluI AGCT 5 cut(s) 50, 263, 278, 321, 336
ApeKI GCWGC 4 cut(s) 47, 318, 410, 413
AsuHPI GGTGA 1 cut(s) 35
BbvI GCAGC 4 cut(s) 59, 330, 397, 400
BccI CCATC 1 cut(s) 164
BciVI GTATCC 1 cut(s) 277
BclI TGATCA 1 cut(s) 229
BfaI CTAG 3 cut(s) 123, 264, 404
BfmI CTRYAG 1 cut(s) 75
BfuI GTATCC 1 cut(s) 277
BisI GCNGC 4 cut(s) 48, 319, 411, 414
BlsI GCNGC 4 cut(s) 49, 320, 412, 415
BmsI GCATC 3 cut(s) 38, 95, 376
BpmI CTGGAG 1 cut(s) 389
BpuEI CTTGAG 1 cut(s) 307
BsaBI GATNNNNATC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 417
Bse1I ACTGG 1 cut(s) 372
Bse8I GATNNNNATC 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 417
BseGI GGATG 2 cut(s) 226, 391
BseJI GATNNNNATC 1 cut(s) 156
BseMII CTCAG 1 cut(s) 351
BseNI ACTGG 1 cut(s) 372
BseXI GCAGC 4 cut(s) 59, 330, 397, 400
Bsp143I GATC 3 cut(s) 79, 229, 342
BspCNI CTCAG 1 cut(s) 350
BspMAI CTGCAG 1 cut(s) 79
BsrI ACTGG 1 cut(s) 372
BssECI CCNNGG 1 cut(s) 417
BssMI GATC 3 cut(s) 79, 229, 342
BssT1I CCWWGG 1 cut(s) 417
BstDEI CTNAG 1 cut(s) 337
BstF5I GGATG 2 cut(s) 226, 391
BstKTI GATC 3 cut(s) 82, 232, 345
BstMBI GATC 3 cut(s) 79, 229, 342
BstMWI GCNNNNNNNGC 2 cut(s) 83, 419
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 4 cut(s) 59, 330, 397, 400
BstXI CCANNNNNNTGG 1 cut(s) 116
BsuI GTATCC 1 cut(s) 277
BtsCI GGATG 2 cut(s) 226, 391
BtsI GCAGTG 1 cut(s) 308
BtsIMutI CAGTG 1 cut(s) 308
Csp6I GTAC 1 cut(s) 120
CviAII CATG 1 cut(s) 68
CviJI RGCY 6 cut(s) 50, 112, 263, 278, 321, 336
CviKI_1 RGCY 6 cut(s) 50, 112, 263, 278, 321, 336
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 337
DpnI GATC 3 cut(s) 81, 231, 344
DpnII GATC 3 cut(s) 79, 229, 342
DraI TTTAAA 1 cut(s) 216
DraIII CACNNNGTG 1 cut(s) 407
Eco130I CCWWGG 1 cut(s) 417
Eco57I CTGAAG 1 cut(s) 186
EcoT14I CCWWGG 1 cut(s) 417
ErhI CCWWGG 1 cut(s) 417
FaeI CATG 1 cut(s) 71
FaiI YATR 5 cut(s) 69, 102, 135, 281, 432
FatI CATG 1 cut(s) 67
FbaI TGATCA 1 cut(s) 229
Fnu4HI GCNGC 4 cut(s) 48, 319, 411, 414
FokI GGATG 2 cut(s) 233, 398
Fsp4HI GCNGC 4 cut(s) 48, 319, 411, 414
FspBI CTAG 3 cut(s) 123, 264, 404
GluI GCNGC 4 cut(s) 48, 319, 411, 414
GsuI CTGGAG 1 cut(s) 389
Hin1II CATG 1 cut(s) 71
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HinfI GANTC 2 cut(s) 18, 126
HphI GGTGA 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 6 cut(s) 166, 193, 252, 270, 340, 351
Hpy8I GTNNAC 1 cut(s) 106
HpyCH4V TGCA 4 cut(s) 47, 77, 290, 434
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 419
HpyF3I CTNAG 1 cut(s) 337
Hsp92II CATG 1 cut(s) 71
Ksp22I TGATCA 1 cut(s) 229
Kzo9I GATC 3 cut(s) 79, 229, 342
LmnI GCTCC 3 cut(s) 55, 315, 394
LpnPI CCDG 6 cut(s) 68, 87, 122, 188, 353, 408
Lsp1109I GCAGC 4 cut(s) 59, 330, 397, 400
LweI GCATC 3 cut(s) 38, 95, 376
MaeI CTAG 3 cut(s) 123, 264, 404
MaeIII GTNAC 1 cut(s) 179
MalI GATC 3 cut(s) 81, 231, 344
MboI GATC 3 cut(s) 79, 229, 342
MboII GAAGA 2 cut(s) 179, 283
MluCI AATT 2 cut(s) 130, 225
MlyI GAGTC 1 cut(s) 27
MmeI TCCRAC 3 cut(s) 293, 342, 363
MnlI CCTC 3 cut(s) 19, 197, 364
MseI TTAA 2 cut(s) 215, 240
MwoI GCNNNNNNNGC 2 cut(s) 83, 419
NdeII GATC 3 cut(s) 79, 229, 342
NlaIII CATG 1 cut(s) 71
PfeI GAWTC 1 cut(s) 126
PkrI GCNGC 4 cut(s) 49, 320, 412, 415
PleI GAGTC 1 cut(s) 26
PpsI GAGTC 1 cut(s) 26
PstI CTGCAG 1 cut(s) 79
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 215, 240
SatI GCNGC 4 cut(s) 48, 319, 411, 414
Sau3AI GATC 3 cut(s) 79, 229, 342
SchI GAGTC 1 cut(s) 27
SetI ASST 9 cut(s) 52, 189, 207, 265, 280, 313, 323, 338, 409
SfaNI GCATC 3 cut(s) 38, 95, 376
SfcI CTRYAG 1 cut(s) 75
SmlI CTYRAG 1 cut(s) 322
SmoI CTYRAG 1 cut(s) 322
Sse9I AATT 2 cut(s) 130, 225
SspMI CTAG 3 cut(s) 123, 264, 404
StyI CCWWGG 1 cut(s) 417
TasI AATT 2 cut(s) 130, 225
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 2 cut(s) 215, 240
Tru9I TTAA 2 cut(s) 215, 240
TscAI CASTG 1 cut(s) 308
TseI GCWGC 4 cut(s) 47, 318, 410, 413
TspDTI ATGAA 1 cut(s) 46
TspGWI ACGGA 1 cut(s) 42
TspRI CASTG 1 cut(s) 308
XspI CTAG 3 cut(s) 123, 264, 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.