Rh3DG284600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
29034652 .. 29035611
960 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG284600.1

Sequence Viewer

Length: 339 bp
ATGTTAACATACCATAGCTTTACTCAGGGAAAGAATGGTTCTTATACTGTGAGATCAAGATATTACAAGGCTCTAAGGCAAGAAGTAGACTTTGTCTACAGCATGCCCATTATTCTCATGACATTCATATTTGGATTTCTGATGCTCTCCCTAAAGTTCTTCGTTTTCTGCGGAGAGCCTGTTACTATTGCCAATATCTATTCAAAAAAGATTTGCTTTAGGGTGACCTTTACATTATTGACTTTGTGGAAAGCAAGACAAGAAATTGTGCAGGAGCACACAACTCCTAATCATATGGGTACTATTCACAGAGGAGGTGCTACAGTCTATGAATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.13

Weight (kDa)

9.55

Isoelectric Point (pI)

32.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 87, 96
AciI CCGC 1 cut(s) 171
AcsI RAATTY 1 cut(s) 332
AfaI GTAC 1 cut(s) 301
AgsI TTSAA 1 cut(s) 204
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
Alw21I GWGCWC 1 cut(s) 279
ApoI RAATTY 1 cut(s) 332
AsuHPI GGTGA 1 cut(s) 235
Bbv12I GWGCWC 1 cut(s) 279
BfmI CTRYAG 2 cut(s) 97, 321
BmsI GCATC 1 cut(s) 132
BsaXI ACNNNNNCTCC 2 cut(s) 165, 195
BseMII CTCAG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 327
BsgI GTGCAG 1 cut(s) 290
BsiHKAI GWGCWC 1 cut(s) 279
Bsp1286I GDGCHC 1 cut(s) 279
Bsp143I GATC 1 cut(s) 53
BspACI CCGC 1 cut(s) 171
BspCNI CTCAG 1 cut(s) 37
BspHI TCATGA 1 cut(s) 117
BssMI GATC 1 cut(s) 53
Bst4CI ACNGT 2 cut(s) 49, 325
BstC8I GCNNGC 1 cut(s) 104
BstDEI CTNAG 2 cut(s) 24, 74
BstEII GGTNACC 1 cut(s) 223
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstNSI RCATGY 1 cut(s) 106
BstPI GGTNACC 1 cut(s) 223
BstSFI CTRYAG 2 cut(s) 97, 321
Cac8I GCNNGC 1 cut(s) 104
CciI TCATGA 1 cut(s) 117
Csp6I GTAC 1 cut(s) 300
CviAII CATG 2 cut(s) 103, 118
CviJI RGCY 3 cut(s) 18, 71, 178
CviKI_1 RGCY 3 cut(s) 18, 71, 178
CviQI GTAC 1 cut(s) 300
DdeI CTNAG 2 cut(s) 24, 74
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
Eco91I GGTNACC 1 cut(s) 223
EcoO65I GGTNACC 1 cut(s) 223
EcoRI GAATTC 1 cut(s) 332
FaeI CATG 2 cut(s) 106, 121
FaiI YATR 9 cut(s) 10, 15, 45, 104, 119, 128, 294, 296, 330
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FatI CATG 2 cut(s) 102, 117
FauNDI CATATG 1 cut(s) 294
FblI GTMKAC 2 cut(s) 87, 96
Hin1II CATG 2 cut(s) 106, 121
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HpaI GTTAAC 1 cut(s) 6
HphI GGTGA 1 cut(s) 235
Hpy166II GTNNAC 3 cut(s) 6, 88, 97
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 2 cut(s) 57, 118
Hpy8I GTNNAC 3 cut(s) 6, 88, 97
HpyCH4III ACNGT 2 cut(s) 49, 325
HpyCH4V TGCA 1 cut(s) 271
HpyF3I CTNAG 2 cut(s) 24, 74
Hsp92II CATG 2 cut(s) 106, 121
KspAI GTTAAC 1 cut(s) 6
Kzo9I GATC 1 cut(s) 53
LmnI GCTCC 1 cut(s) 274
LpnPI CCDG 3 cut(s) 11, 192, 257
LweI GCATC 1 cut(s) 132
MaeIII GTNAC 2 cut(s) 181, 223
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MboII GAAGA 1 cut(s) 151
MhlI GDGCHC 1 cut(s) 279
MluCI AATT 2 cut(s) 264, 332
MnlI CCTC 2 cut(s) 305, 308
MseI TTAA 1 cut(s) 5
NdeI CATATG 1 cut(s) 294
NdeII GATC 1 cut(s) 53
NlaIII CATG 2 cut(s) 106, 121
NmuCI GTSAC 1 cut(s) 223
NspI RCATGY 1 cut(s) 106
PaeI GCATGC 1 cut(s) 106
PagI TCATGA 1 cut(s) 117
PflFI GACNNNGTC 1 cut(s) 92
PspEI GGTNACC 1 cut(s) 223
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 1 cut(s) 301
RsaNI GTAC 1 cut(s) 300
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 53
SduI GDGCHC 1 cut(s) 279
SetI ASST 3 cut(s) 20, 230, 319
SfaNI GCATC 1 cut(s) 132
SfcI CTRYAG 2 cut(s) 97, 321
SphI GCATGC 1 cut(s) 106
Sse9I AATT 2 cut(s) 264, 332
SsiI CCGC 1 cut(s) 171
TaaI ACNGT 2 cut(s) 49, 325
TasI AATT 2 cut(s) 264, 332
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TseFI GTSAC 1 cut(s) 223
Tsp45I GTSAC 1 cut(s) 223
TspDTI ATGAA 1 cut(s) 115
Tth111I GACNNNGTC 1 cut(s) 92
XapI RAATTY 1 cut(s) 332
XceI RCATGY 1 cut(s) 106
XmiI GTMKAC 2 cut(s) 87, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.