Rh4AG114600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
24779230 .. 24787805
8576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG114600.1

Sequence Viewer

Length: 177 bp
ATGTTGAAGAATACCAATGCATCCATATGGGCTGATCTTGCTGTCATTCGCTGTTCTGCTACACTGATGCTGCACAGAAGAAGTTTTCTACATCCCCTGATGCTGCACAGGAAACGACTGAAGAAGTATGCAACCCTTGATGATGCCAAGAACAAGATCGGGCTTAGGGGTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.7

Weight (kDa)

10.67

Isoelectric Point (pI)

29.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 7
ApeKI GCWGC 2 cut(s) 70, 103
BbvI GCAGC 2 cut(s) 57, 90
BisI GCNGC 2 cut(s) 71, 104
BlsI GCNGC 2 cut(s) 72, 105
BmsI GCATC 4 cut(s) 29, 57, 90, 133
Bpu10I CCTNAGC 1 cut(s) 164
BseGI GGATG 2 cut(s) 20, 91
BseXI GCAGC 2 cut(s) 57, 90
BsgI GTGCAG 2 cut(s) 56, 89
Bsp143I GATC 2 cut(s) 34, 156
BssMI GATC 2 cut(s) 34, 156
BstDEI CTNAG 1 cut(s) 164
BstF5I GGATG 2 cut(s) 20, 91
BstKTI GATC 2 cut(s) 37, 159
BstMBI GATC 2 cut(s) 34, 156
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstV1I GCAGC 2 cut(s) 57, 90
BtsCI GGATG 2 cut(s) 20, 91
BtsIMutI CAGTG 1 cut(s) 62
CviJI RGCY 2 cut(s) 32, 163
CviKI_1 RGCY 2 cut(s) 32, 163
DdeI CTNAG 1 cut(s) 164
DpnI GATC 2 cut(s) 36, 158
DpnII GATC 2 cut(s) 34, 156
Eco57I CTGAAG 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 22
FaiI YATR 3 cut(s) 26, 28, 129
FauNDI CATATG 1 cut(s) 26
Fnu4HI GCNGC 2 cut(s) 71, 104
FokI GGATG 2 cut(s) 7, 78
Fsp4HI GCNGC 2 cut(s) 71, 104
GluI GCNGC 2 cut(s) 71, 104
HpyCH4V TGCA 4 cut(s) 20, 73, 106, 131
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 164
Kzo9I GATC 2 cut(s) 34, 156
LpnPI CCDG 2 cut(s) 94, 110
Lsp1109I GCAGC 2 cut(s) 57, 90
LweI GCATC 4 cut(s) 29, 57, 90, 133
MalI GATC 2 cut(s) 36, 158
MboI GATC 2 cut(s) 34, 156
MboII GAAGA 3 cut(s) 19, 90, 133
Mph1103I ATGCAT 1 cut(s) 22
MslI CAYNNNNRTG 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeI CATATG 1 cut(s) 26
NdeII GATC 2 cut(s) 34, 156
NsiI ATGCAT 1 cut(s) 22
PkrI GCNGC 2 cut(s) 72, 105
RseI CAYNNNNRTG 1 cut(s) 25
SatI GCNGC 2 cut(s) 71, 104
Sau3AI GATC 2 cut(s) 34, 156
SfaNI GCATC 4 cut(s) 29, 57, 90, 133
SgeI CNNG 7 cut(s) 50, 109, 121, 149, 160, 166, 172
SmiMI CAYNNNNRTG 1 cut(s) 25
TscAI CASTG 1 cut(s) 69
TseI GCWGC 2 cut(s) 70, 103
TspRI CASTG 1 cut(s) 69
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.