Rh4CG128600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0011624
Physical Location & Seq
Reverse (-)
25212969 .. 25214670
1702 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG128600.1

Sequence Viewer

Length: 258 bp
ATGGAAGTCCAGGAGTCACAGGATCGGAAGCCGAGCGCCGACTGCTTCTACAGCCTATTCTTGCCGACCATGGTCTACCGCAACACCGCCGTGGAGCTTCTGTTCAATTTCCTCACCACTTCCGACGAGGCCGAAGTCGAGGCTCGCCTCCGCGAGGCTCGCCTCAAAGGAAGACGCCTTCGCCACCTCCAGAACGATTATCAGAGCGATCTACTCCGACGAGATCAGCTATCGCGTGCTGGAGGTCCTCCAGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.87

Weight (kDa)

6.57

Isoelectric Point (pI)

55.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 75
AccII CGCG 2 cut(s) 153, 235
AciI CCGC 3 cut(s) 79, 87, 151
AclWI GGATC 1 cut(s) 30
AcyI GRCGYC 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 1 cut(s) 106
AjnI CCWGG 2 cut(s) 9, 250
AleI CACNNNNGTG 1 cut(s) 89
AloI GAACNNNNNNTCC 2 cut(s) 86, 118
AluBI AGCT 2 cut(s) 97, 229
AluI AGCT 2 cut(s) 97, 229
AlwI GGATC 1 cut(s) 30
AoxI GGCC 1 cut(s) 129
AspLEI GCGC 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 245
AsuHPI GGTGA 1 cut(s) 106
AvaII GGWCC 1 cut(s) 245
BbsI GAAGAC 1 cut(s) 178
BceAI ACGGC 1 cut(s) 74
BciT130I CCWGG 2 cut(s) 11, 252
BfmI CTRYAG 1 cut(s) 49
BfoI RGCGCY 1 cut(s) 39
Bme1390I CCNGG 2 cut(s) 11, 252
Bme18I GGWCC 1 cut(s) 245
BmgT120I GGNCC 1 cut(s) 245
BmrFI CCNGG 2 cut(s) 11, 252
BoxI GACNNNNGTC 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 178
BpmI CTGGAG 2 cut(s) 173, 234
BsaHI GRCGYC 1 cut(s) 175
BsaJI CCNNGG 2 cut(s) 69, 90
BsaXI ACNNNNNCTCC 2 cut(s) 86, 116
Bsc4I CCNNNNNNNGG 1 cut(s) 154
BseBI CCWGG 2 cut(s) 11, 252
BseDI CCNNGG 2 cut(s) 69, 90
BseLI CCNNNNNNNGG 1 cut(s) 154
Bsh1236I CGCG 2 cut(s) 153, 235
BshFI GGCC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 154
BsnI GGCC 1 cut(s) 131
Bsp143I GATC 3 cut(s) 22, 208, 223
Bsp19I CCATGG 1 cut(s) 69
BspACI CCGC 3 cut(s) 79, 87, 151
BspANI GGCC 1 cut(s) 131
BspFNI CGCG 2 cut(s) 153, 235
BspPI GGATC 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 69, 90
BssMI GATC 3 cut(s) 22, 208, 223
BssNI GRCGYC 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 69
Bst2UI CCWGG 2 cut(s) 11, 252
BstACI GRCGYC 1 cut(s) 175
BstC8I GCNNGC 3 cut(s) 145, 160, 237
BstDSI CCRYGG 2 cut(s) 69, 90
BstENI CCTNNNNNAGG 1 cut(s) 152
BstFNI CGCG 2 cut(s) 153, 235
BstH2I RGCGCY 1 cut(s) 39
BstHHI GCGC 1 cut(s) 38
BstKTI GATC 3 cut(s) 25, 211, 226
BstMBI GATC 3 cut(s) 22, 208, 223
BstMWI GCNNNNNNNGC 3 cut(s) 42, 51, 159
BstNI CCWGG 2 cut(s) 11, 252
BstPAI GACNNNNGTC 1 cut(s) 71
BstSCI CCNGG 2 cut(s) 9, 250
BstSFI CTRYAG 1 cut(s) 49
BstUI CGCG 2 cut(s) 153, 235
BstV2I GAAGAC 1 cut(s) 178
BsuRI GGCC 1 cut(s) 131
BtgI CCRYGG 2 cut(s) 69, 90
Cac8I GCNNGC 3 cut(s) 145, 160, 237
CfoI GCGC 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 245
CseI GACGC 1 cut(s) 183
CviAII CATG 1 cut(s) 70
CviJI RGCY 8 cut(s) 31, 54, 97, 131, 143, 158, 229, 255
CviKI_1 RGCY 8 cut(s) 31, 54, 97, 131, 143, 158, 229, 255
DpnI GATC 3 cut(s) 24, 210, 225
DpnII GATC 3 cut(s) 22, 208, 223
Eco130I CCWWGG 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 245
EcoNI CCTNNNNNAGG 1 cut(s) 152
EcoO109I RGGNCCY 1 cut(s) 245
EcoRII CCWGG 2 cut(s) 9, 250
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 1 cut(s) 73
FaiI YATR 1 cut(s) 71
FatI CATG 1 cut(s) 69
FblI GTMKAC 1 cut(s) 75
GlaI GCGC 1 cut(s) 37
GsuI CTGGAG 2 cut(s) 173, 234
HaeII RGCGCY 1 cut(s) 39
HaeIII GGCC 1 cut(s) 131
HgaI GACGC 1 cut(s) 183
HhaI GCGC 1 cut(s) 38
Hin1I GRCGYC 1 cut(s) 175
Hin1II CATG 1 cut(s) 73
Hin6I GCGC 1 cut(s) 36
HinP1I GCGC 1 cut(s) 36
HinfI GANTC 1 cut(s) 14
HphI GGTGA 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 4 cut(s) 27, 124, 204, 218
Hpy188III TCNNGA 1 cut(s) 190
Hpy8I GTNNAC 1 cut(s) 76
Hpy99I CGWCG 2 cut(s) 128, 222
HpyAV CCTTC 1 cut(s) 188
HpyF10VI GCNNNNNNNGC 3 cut(s) 42, 51, 159
Hsp92I GRCGYC 1 cut(s) 175
Hsp92II CATG 1 cut(s) 73
HspAI GCGC 1 cut(s) 36
Kzo9I GATC 3 cut(s) 22, 208, 223
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 5 cut(s) 5, 23, 203, 225, 237
MaeIII GTNAC 1 cut(s) 15
MalI GATC 3 cut(s) 24, 210, 225
MboI GATC 3 cut(s) 22, 208, 223
MboII GAAGA 1 cut(s) 183
MluCI AATT 1 cut(s) 106
MlyI GAGTC 1 cut(s) 23
MmeI TCCRAC 2 cut(s) 147, 241
MnlI CCTC 9 cut(s) 121, 122, 133, 148, 158, 173, 197, 236, 258
MslI CAYNNNNRTG 1 cut(s) 89
MspR9I CCNGG 2 cut(s) 11, 252
MvaI CCWGG 2 cut(s) 11, 252
MvnI CGCG 2 cut(s) 153, 235
MwoI GCNNNNNNNGC 3 cut(s) 42, 51, 159
NcoI CCATGG 1 cut(s) 69
NdeII GATC 3 cut(s) 22, 208, 223
NlaIII CATG 1 cut(s) 73
NmeAIII GCCGAG 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 15
OliI CACNNNNGTG 1 cut(s) 89
PfoI TCCNGGA 1 cut(s) 9
PleI GAGTC 1 cut(s) 22
PpsI GAGTC 1 cut(s) 22
PpuMI RGGWCCY 1 cut(s) 245
PshAI GACNNNNGTC 1 cut(s) 71
Psp5II RGGWCCY 1 cut(s) 245
Psp6I CCWGG 2 cut(s) 9, 250
PspGI CCWGG 2 cut(s) 9, 250
PspPI GGNCC 1 cut(s) 245
PspPPI RGGWCCY 1 cut(s) 245
RseI CAYNNNNRTG 1 cut(s) 89
Sau3AI GATC 3 cut(s) 22, 208, 223
Sau96I GGNCC 1 cut(s) 245
SchI GAGTC 1 cut(s) 23
ScrFI CCNGG 2 cut(s) 11, 252
SetI ASST 4 cut(s) 99, 189, 231, 247
SfcI CTRYAG 1 cut(s) 49
SinI GGWCC 1 cut(s) 245
SmiMI CAYNNNNRTG 1 cut(s) 89
Sse9I AATT 1 cut(s) 106
SsiI CCGC 3 cut(s) 79, 87, 151
StyD4I CCNGG 2 cut(s) 9, 250
StyI CCWWGG 1 cut(s) 69
TaqI TCGA 1 cut(s) 138
TasI AATT 1 cut(s) 106
TseFI GTSAC 1 cut(s) 15
Tsp45I GTSAC 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 245
XagI CCTNNNNNAGG 1 cut(s) 152
XmiI GTMKAC 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.