Rh4CG441200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
67820829 .. 67823421
2593 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG441200.1

Sequence Viewer

Length: 477 bp
ATGGCTTCTCAGATCACATCGGCGATGTTACTTGCGGCGTGTTTCGCCGTCCTGATCATGGTTTGTGCAGCTGTTGGAGAAGGCCAGCGGCCCGTACCTCGAAACATGCAAGGAGTGAGGCCGGTACATGAAATAAAAGCCTTGAAAGGGTTGAAAGTCACAGAAGGCATGAGGCCAATACCAAAAGTCGTGACACTGATGGCGCCGAAGCTCGACATGCCCCCAATGCCTGGTACCACCCCCGCGCTCGGCATGCGGCCAATACATAAAAACATGAAAGTCACAAAAGGCATGAGGCCAATACCAAAAGTCGTGACAGAGAGGGCGGCGCCAAAGCTCGACATGCCCCCAATGCCCGAATCGACAATGGTCATGGAAGAGCGCTGGGAAGTTGTGGGAGACACTTACTGCAATGCTAGGTTCTCGGAGTTACAGAACCTGATCAAAGCAACGACTTGTCATGCACCAAGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

158

Amino Acids

17.23

Weight (kDa)

9.65

Isoelectric Point (pI)

50.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 233
AccB1I GGYRCC 3 cut(s) 202, 233, 328
AccB7I CCANNNNNTGG 1 cut(s) 230
AccII CGCG 1 cut(s) 245
AciI CCGC 5 cut(s) 35, 88, 243, 256, 326
AcoI YGGCCR 1 cut(s) 257
AcyI GRCGYC 2 cut(s) 203, 329
AfaI GTAC 3 cut(s) 96, 126, 235
AfeI AGCGCT 1 cut(s) 383
AfiI CCNNNNNNNGG 4 cut(s) 58, 147, 230, 248
AgsI TTSAA 2 cut(s) 145, 154
AjnI CCWGG 1 cut(s) 229
AluBI AGCT 3 cut(s) 71, 211, 337
AluI AGCT 3 cut(s) 71, 211, 337
Alw26I GTCTC 1 cut(s) 393
AlwNI CAGNNNCTG 1 cut(s) 439
Aor51HI AGCGCT 1 cut(s) 383
AoxI GGCC 6 cut(s) 82, 89, 119, 173, 257, 296
ApeKI GCWGC 1 cut(s) 68
Asp718I GGTACC 1 cut(s) 233
AspLEI GCGC 4 cut(s) 205, 247, 331, 384
AspS9I GGNCC 1 cut(s) 90
BanI GGYRCC 3 cut(s) 202, 233, 328
BbvI GCAGC 1 cut(s) 80
BccI CCATC 1 cut(s) 193
BceAI ACGGC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 231
BclI TGATCA 2 cut(s) 54, 441
BcoDI GTCTC 1 cut(s) 393
BfaI CTAG 1 cut(s) 417
BfoI RGCGCY 3 cut(s) 206, 332, 385
BisI GCNGC 5 cut(s) 36, 69, 89, 257, 327
BlsI GCNGC 5 cut(s) 37, 70, 90, 258, 328
Bme1390I CCNGG 1 cut(s) 231
BmgT120I GGNCC 1 cut(s) 90
BmiI GGNNCC 3 cut(s) 204, 235, 330
BmrFI CCNGG 1 cut(s) 231
BoxI GACNNNNGTC 1 cut(s) 368
BsaHI GRCGYC 2 cut(s) 203, 329
Bsc4I CCNNNNNNNGG 4 cut(s) 58, 147, 230, 248
Bse118I RCCGGY 1 cut(s) 121
Bse3DI GCAATG 1 cut(s) 418
BseBI CCWGG 1 cut(s) 231
BseLI CCNNNNNNNGG 4 cut(s) 58, 147, 230, 248
BseMI GCAATG 1 cut(s) 418
BseMII CTCAG 1 cut(s) 23
BseXI GCAGC 1 cut(s) 80
BseYI CCCAGC 1 cut(s) 384
BsgI GTGCAG 1 cut(s) 87
Bsh1236I CGCG 1 cut(s) 245
BshFI GGCC 6 cut(s) 84, 91, 121, 175, 259, 298
BshNI GGYRCC 3 cut(s) 202, 233, 328
BsiSI CCGG 1 cut(s) 122
BslI CCNNNNNNNGG 4 cut(s) 58, 147, 230, 248
BsmAI GTCTC 1 cut(s) 393
BsnI GGCC 6 cut(s) 84, 91, 121, 175, 259, 298
Bsp143I GATC 3 cut(s) 12, 54, 441
BspACI CCGC 5 cut(s) 35, 88, 243, 256, 326
BspANI GGCC 6 cut(s) 84, 91, 121, 175, 259, 298
BspCNI CTCAG 1 cut(s) 22
BspFNI CGCG 1 cut(s) 245
BspLI GGNNCC 3 cut(s) 204, 235, 330
BspQI GCTCTTC 1 cut(s) 372
BspT107I GGYRCC 3 cut(s) 202, 233, 328
BsrDI GCAATG 1 cut(s) 418
BsrFI RCCGGY 1 cut(s) 121
BssAI RCCGGY 1 cut(s) 121
BssMI GATC 3 cut(s) 12, 54, 441
BssNI GRCGYC 2 cut(s) 203, 329
Bst2UI CCWGG 1 cut(s) 231
Bst6I CTCTTC 1 cut(s) 372
BstACI GRCGYC 2 cut(s) 203, 329
BstC8I GCNNGC 2 cut(s) 86, 254
BstDEI CTNAG 1 cut(s) 9
BstFNI CGCG 1 cut(s) 245
BstH2I RGCGCY 3 cut(s) 206, 332, 385
BstHHI GCGC 4 cut(s) 205, 247, 331, 384
BstKTI GATC 3 cut(s) 15, 57, 444
BstMAI GTCTC 1 cut(s) 393
BstMBI GATC 3 cut(s) 12, 54, 441
BstMWI GCNNNNNNNGC 6 cut(s) 44, 217, 226, 253, 343, 352
BstNI CCWGG 1 cut(s) 231
BstNSI RCATGY 4 cut(s) 109, 220, 256, 346
BstPAI GACNNNNGTC 1 cut(s) 368
BstSCI CCNGG 1 cut(s) 229
BstUI CGCG 1 cut(s) 245
BstV1I GCAGC 1 cut(s) 80
BsuRI GGCC 6 cut(s) 84, 91, 121, 175, 259, 298
BtgZI GCGATG 1 cut(s) 38
BtsIMutI CAGTG 1 cut(s) 194
Cac8I GCNNGC 2 cut(s) 86, 254
CaiI CAGNNNCTG 1 cut(s) 439
CfoI GCGC 4 cut(s) 205, 247, 331, 384
Cfr10I RCCGGY 1 cut(s) 121
Cfr13I GGNCC 1 cut(s) 90
Csp6I GTAC 3 cut(s) 95, 125, 234
CviQI GTAC 3 cut(s) 95, 125, 234
DdeI CTNAG 1 cut(s) 9
DinI GGCGCC 2 cut(s) 204, 330
DpnI GATC 3 cut(s) 14, 56, 443
DpnII GATC 3 cut(s) 12, 54, 441
EaeI YGGCCR 1 cut(s) 257
Eam1104I CTCTTC 1 cut(s) 372
EarI CTCTTC 1 cut(s) 372
Eco47III AGCGCT 1 cut(s) 383
EcoRII CCWGG 1 cut(s) 229
EgeI GGCGCC 2 cut(s) 204, 330
EheI GGCGCC 2 cut(s) 204, 330
FauI CCCGC 1 cut(s) 250
FbaI TGATCA 2 cut(s) 54, 441
Fnu4HI GCNGC 5 cut(s) 36, 69, 89, 257, 327
Fsp4HI GCNGC 5 cut(s) 36, 69, 89, 257, 327
FspBI CTAG 1 cut(s) 417
GlaI GCGC 4 cut(s) 204, 246, 330, 383
GluI GCNGC 5 cut(s) 36, 69, 89, 257, 327
GsaI CCCAGC 1 cut(s) 388
HaeII RGCGCY 3 cut(s) 206, 332, 385
HaeIII GGCC 6 cut(s) 84, 91, 121, 175, 259, 298
HapII CCGG 1 cut(s) 122
HhaI GCGC 4 cut(s) 205, 247, 331, 384
Hin1I GRCGYC 2 cut(s) 203, 329
Hin6I GCGC 4 cut(s) 203, 245, 329, 382
HinP1I GCGC 4 cut(s) 203, 245, 329, 382
HinfI GANTC 1 cut(s) 359
HpaII CCGG 1 cut(s) 122
Hpy188I TCNGA 2 cut(s) 12, 427
Hpy188III TCNNGA 4 cut(s) 52, 190, 313, 474
HpyAV CCTTC 2 cut(s) 74, 158
HpyCH4V TGCA 4 cut(s) 68, 109, 411, 464
HpyF10VI GCNNNNNNNGC 6 cut(s) 44, 217, 226, 253, 343, 352
HpyF3I CTNAG 1 cut(s) 9
Hsp92I GRCGYC 2 cut(s) 203, 329
HspAI GCGC 4 cut(s) 203, 245, 329, 382
KasI GGCGCC 2 cut(s) 202, 328
KpnI GGTACC 1 cut(s) 237
Ksp22I TGATCA 2 cut(s) 54, 441
Kzo9I GATC 3 cut(s) 12, 54, 441
LguI GCTCTTC 1 cut(s) 372
LpnPI CCDG 7 cut(s) 65, 98, 135, 216, 243, 370, 452
Lsp1109I GCAGC 1 cut(s) 80
MaeI CTAG 1 cut(s) 417
MaeIII GTNAC 6 cut(s) 27, 157, 190, 280, 313, 429
MalI GATC 3 cut(s) 14, 56, 443
MboI GATC 3 cut(s) 12, 54, 441
MboII GAAGA 1 cut(s) 389
Mly113I GGCGCC 2 cut(s) 203, 329
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 5 cut(s) 108, 111, 165, 288, 315
MspA1I CMGCKG 2 cut(s) 71, 88
MspI CCGG 1 cut(s) 122
MspR9I CCNGG 1 cut(s) 231
MvaI CCWGG 1 cut(s) 231
MvnI CGCG 1 cut(s) 245
MwoI GCNNNNNNNGC 6 cut(s) 44, 217, 226, 253, 343, 352
NarI GGCGCC 2 cut(s) 203, 329
NdeII GATC 3 cut(s) 12, 54, 441
NlaIV GGNNCC 3 cut(s) 204, 235, 330
NmeAIII GCCGAG 1 cut(s) 228
NmuCI GTSAC 4 cut(s) 157, 190, 280, 313
NspI RCATGY 4 cut(s) 109, 220, 256, 346
PaeI GCATGC 1 cut(s) 256
PciSI GCTCTTC 1 cut(s) 372
PfeI GAWTC 1 cut(s) 359
PflMI CCANNNNNTGG 1 cut(s) 230
PkrI GCNGC 5 cut(s) 37, 70, 90, 258, 328
PluTI GGCGCC 2 cut(s) 206, 332
PshAI GACNNNNGTC 1 cut(s) 368
Psp6I CCWGG 1 cut(s) 229
PspFI CCCAGC 1 cut(s) 384
PspGI CCWGG 1 cut(s) 229
PspN4I GGNNCC 3 cut(s) 204, 235, 330
PspPI GGNCC 1 cut(s) 90
PstNI CAGNNNCTG 1 cut(s) 439
PvuII CAGCTG 1 cut(s) 71
RsaI GTAC 3 cut(s) 96, 126, 235
RsaNI GTAC 3 cut(s) 95, 125, 234
SapI GCTCTTC 1 cut(s) 372
SatI GCNGC 5 cut(s) 36, 69, 89, 257, 327
Sau3AI GATC 3 cut(s) 12, 54, 441
Sau96I GGNCC 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 231
SetI ASST 6 cut(s) 73, 100, 213, 339, 422, 441
SfoI GGCGCC 2 cut(s) 204, 330
SphI GCATGC 1 cut(s) 256
SsiI CCGC 5 cut(s) 35, 88, 243, 256, 326
SspDI GGCGCC 2 cut(s) 202, 328
SspMI CTAG 1 cut(s) 417
StyD4I CCNGG 1 cut(s) 229
TaqI TCGA 4 cut(s) 100, 213, 339, 362
TauI GCSGC 4 cut(s) 38, 91, 259, 329
TfiI GAWTC 1 cut(s) 359
TscAI CASTG 1 cut(s) 201
TseFI GTSAC 4 cut(s) 157, 190, 280, 313
TseI GCWGC 1 cut(s) 68
Tsp45I GTSAC 4 cut(s) 157, 190, 280, 313
TspDTI ATGAA 2 cut(s) 144, 290
TspRI CASTG 1 cut(s) 201
Van91I CCANNNNNTGG 1 cut(s) 230
XceI RCATGY 4 cut(s) 109, 220, 256, 346
XspI CTAG 1 cut(s) 417
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.