Rh4DG020400

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
3202441 .. 3202653
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG020400.1

Sequence Viewer

Length: 213 bp
ATGGAGAGTCATAGTGTAATTCCAGACAGGTGTAGCTATAGTTCTCTGATACAAATTTTGGCTAGTGGTGATATGCCACATACTGCAATGCCTTATCTGAAGAAGATGCAGGAGTCAGGGTTGGTACGTGATTGCATCCCCTATTGTGCTGTGATTTCAAGCTTTGCAAAATTAGGTCAATTGGAAAGGGCAGAGGAAGTTTATAAACAGATG

Protein Analysis

71

Amino Acids

7.98

Weight (kDa)

6.03

Isoelectric Point (pI)

42.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 204
AcsI RAATTY 1 cut(s) 54
AcuI CTGAAG 1 cut(s) 119
AfaI GTAC 1 cut(s) 126
AgsI TTSAA 1 cut(s) 159
AluBI AGCT 2 cut(s) 36, 162
AluI AGCT 2 cut(s) 36, 162
ApoI RAATTY 1 cut(s) 54
AsuHPI GGTGA 1 cut(s) 80
BfaI CTAG 1 cut(s) 63
BfmI CTRYAG 1 cut(s) 37
BmsI GCATC 2 cut(s) 96, 144
BsaAI YACGTR 1 cut(s) 128
BsaXI ACNNNNNCTCC 2 cut(s) 104, 134
Bse3DI GCAATG 1 cut(s) 93
BseGI GGATG 1 cut(s) 135
BseMI GCAATG 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 93
BstBAI YACGTR 1 cut(s) 128
BstF5I GGATG 1 cut(s) 135
BstSFI CTRYAG 1 cut(s) 37
BtsCI GGATG 1 cut(s) 135
Csp6I GTAC 1 cut(s) 125
CviJI RGCY 3 cut(s) 36, 62, 162
CviKI_1 RGCY 3 cut(s) 36, 62, 162
CviQI GTAC 1 cut(s) 125
Eco57I CTGAAG 1 cut(s) 119
FaiI YATR 5 cut(s) 12, 39, 74, 81, 204
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 63
HindIII AAGCTT 1 cut(s) 160
HinfI GANTC 2 cut(s) 7, 113
HphI GGTGA 1 cut(s) 80
Hpy188I TCNGA 2 cut(s) 48, 99
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4IV ACGT 1 cut(s) 127
HpyCH4V TGCA 4 cut(s) 86, 109, 135, 167
HpySE526I ACGT 1 cut(s) 127
LpnPI CCDG 4 cut(s) 13, 36, 95, 102
LweI GCATC 2 cut(s) 96, 144
MaeI CTAG 1 cut(s) 63
MaeII ACGT 1 cut(s) 127
MboII GAAGA 2 cut(s) 112, 115
MfeI CAATTG 1 cut(s) 179
MluCI AATT 4 cut(s) 18, 54, 170, 179
MlyI GAGTC 2 cut(s) 16, 122
MnlI CCTC 1 cut(s) 187
MunI CAATTG 1 cut(s) 179
PleI GAGTC 2 cut(s) 15, 121
PpsI GAGTC 2 cut(s) 15, 121
Ppu21I YACGTR 1 cut(s) 128
PsiI TTATAA 1 cut(s) 204
PsrI GAACNNNNNNTAC 2 cut(s) 25, 57
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
SchI GAGTC 2 cut(s) 16, 122
SetI ASST 5 cut(s) 32, 38, 130, 164, 178
SfaNI GCATC 2 cut(s) 96, 144
SfcI CTRYAG 1 cut(s) 37
SgeI CNNG 7 cut(s) 35, 40, 75, 122, 129, 140, 171
Sse9I AATT 4 cut(s) 18, 54, 170, 179
SspMI CTAG 1 cut(s) 63
TaiI ACGT 1 cut(s) 130
TasI AATT 4 cut(s) 18, 54, 170, 179
XapI RAATTY 1 cut(s) 54
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.