Rh5BG027900

oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
1951843 .. 1953334
1492 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG027900.1

Sequence Viewer

Length: 186 bp
ATGGAAGAGAGCAACCTCAGTAAACCATTTCTTAAAGAACTTGAGAAGAAAGTGATGCCTGCAATTGAGAATGGCGGCGTGAAACTTGTCATTCACAAGGAGGTTTTTACATTCAAAGAAGCAACCGAGGCATACAAACTCAAGAAAAGTGACAATCATATCGGAAAGATATTGCTTCATCCTTGA

Protein Analysis

61

Amino Acids

6.98

Weight (kDa)

8.97

Isoelectric Point (pI)

45.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADH_zinc_N_2 PF13602 9 - 59 5.5e-06 Zinc-binding dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 75
AgsI TTSAA 1 cut(s) 115
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
BmsI GCATC 1 cut(s) 45
BpuEI CTTGAG 2 cut(s) 62, 125
BsaJI CCNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 178
BseMII CTCAG 1 cut(s) 31
BspACI CCGC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 17
BstF5I GGATG 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 178
Cac8I GCNNGC 1 cut(s) 60
DdeI CTNAG 1 cut(s) 17
FaiI YATR 2 cut(s) 133, 159
Fnu4HI GCNGC 1 cut(s) 76
FokI GGATG 1 cut(s) 165
Fsp4HI GCNGC 1 cut(s) 76
GluI GCNGC 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 62
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 17
LpnPI CCDG 1 cut(s) 72
LweI GCATC 1 cut(s) 45
MaeIII GTNAC 1 cut(s) 149
MboII GAAGA 2 cut(s) 17, 58
MfeI CAATTG 1 cut(s) 63
MluCI AATT 1 cut(s) 63
MnlI CCTC 3 cut(s) 26, 94, 121
MseI TTAA 1 cut(s) 33
MunI CAATTG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 128
NmuCI GTSAC 1 cut(s) 149
PkrI GCNGC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 33
SatI GCNGC 1 cut(s) 76
SetI ASST 2 cut(s) 18, 105
SfaNI GCATC 1 cut(s) 45
SgeI CNNG 7 cut(s) 53, 71, 91, 98, 109, 139, 154
SmlI CTYRAG 2 cut(s) 41, 140
SmoI CTYRAG 2 cut(s) 41, 140
Sse9I AATT 1 cut(s) 63
SsiI CCGC 1 cut(s) 75
TasI AATT 1 cut(s) 63
TauI GCSGC 1 cut(s) 78
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.