Rh6CG027900
MADS Family

Agamous-like MADS-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0009648
Physical Location & Seq
Forward (+)
2467315 .. 2467701
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG027900.1

Sequence Viewer

Length: 300 bp
ATGGGTCGTCAGAGAATTGAGGTGCGAAAATTGGAAAAGATTGCTCTAATCCTAGATTCTCCAGCAAAGAAGACATACTCGTTCGGCTGCCCTCATGTGCCAGCAGTTATTGACCGCTATGAGAACATGAACGCTGCTCTCTTGGCCAACAATGGCAACACTGAGCAGCTTATGGAGGCTGCACATAGAAGACAAACATACGATTTGATGGCGGAGTTGGATGCTATTAATGAGGATCTACACACAGAGACAATGAAGAGAAATGTGCTTAATAAAAGGGAGAGGGACTGCCAGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04010 ko04013 ko04022 ko04371 ko04921 ko05202 ko05418 map04010 map04013 map04022 map04371 map04921 map05202 map05418
Pfam Domains
Protein Families
SRF-TF

Protein Analysis

99

Amino Acids

11.4

Weight (kDa)

6.83

Isoelectric Point (pI)

52.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 115, 212
AclWI GGATC 1 cut(s) 243
AcoI YGGCCR 1 cut(s) 144
AjnI CCWGG 1 cut(s) 291
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
Alw26I GTCTC 1 cut(s) 242
AlwI GGATC 1 cut(s) 243
AoxI GGCC 1 cut(s) 144
ApeKI GCWGC 4 cut(s) 87, 134, 166, 179
AseI ATTAAT 1 cut(s) 228
BalI TGGCCA 1 cut(s) 146
BbsI GAAGAC 2 cut(s) 77, 196
BbvI GCAGC 4 cut(s) 74, 121, 166, 178
BccI CCATC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 293
BcoDI GTCTC 1 cut(s) 242
BfaI CTAG 1 cut(s) 53
BisI GCNGC 4 cut(s) 88, 135, 167, 180
BlsI GCNGC 4 cut(s) 89, 136, 168, 181
Bme1390I CCNGG 1 cut(s) 293
BmrFI CCNGG 1 cut(s) 293
BmsI GCATC 1 cut(s) 211
BpiI GAAGAC 2 cut(s) 77, 196
BpmI CTGGAG 1 cut(s) 45
BseBI CCWGG 1 cut(s) 293
BseGI GGATG 1 cut(s) 226
BseMII CTCAG 1 cut(s) 153
BseXI GCAGC 4 cut(s) 74, 121, 166, 178
BsgI GTGCAG 1 cut(s) 165
BshFI GGCC 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 242
BsnI GGCC 1 cut(s) 146
Bsp143I GATC 1 cut(s) 235
BspACI CCGC 2 cut(s) 115, 212
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 154
BspPI GGATC 1 cut(s) 243
BssMI GATC 1 cut(s) 235
Bst2UI CCWGG 1 cut(s) 293
Bst6I CTCTTC 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 102
BstDEI CTNAG 2 cut(s) 162, 297
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 1 cut(s) 238
BstMAI GTCTC 1 cut(s) 242
BstMBI GATC 1 cut(s) 235
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstNI CCWGG 1 cut(s) 293
BstSCI CCNGG 1 cut(s) 291
BstV1I GCAGC 4 cut(s) 74, 121, 166, 178
BstV2I GAAGAC 2 cut(s) 77, 196
BstX2I RGATCY 1 cut(s) 235
BstYI RGATCY 1 cut(s) 235
BsuRI GGCC 1 cut(s) 146
BtsCI GGATG 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 102
CviAII CATG 2 cut(s) 95, 127
CviJI RGCY 5 cut(s) 87, 146, 169, 179, 296
CviKI_1 RGCY 5 cut(s) 87, 146, 169, 179, 296
DdeI CTNAG 2 cut(s) 162, 297
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
EaeI YGGCCR 1 cut(s) 144
Eam1104I CTCTTC 1 cut(s) 251
EarI CTCTTC 1 cut(s) 251
EciI GGCGGA 1 cut(s) 227
EcoRII CCWGG 1 cut(s) 291
FaeI CATG 2 cut(s) 98, 130
FaiI YATR 7 cut(s) 76, 96, 120, 128, 173, 186, 199
FatI CATG 2 cut(s) 94, 126
Fnu4HI GCNGC 4 cut(s) 88, 135, 167, 180
FokI GGATG 1 cut(s) 233
Fsp4HI GCNGC 4 cut(s) 88, 135, 167, 180
FspBI CTAG 1 cut(s) 53
GluI GCNGC 4 cut(s) 88, 135, 167, 180
GsuI CTGGAG 1 cut(s) 45
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 2 cut(s) 98, 130
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 12
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 2 cut(s) 162, 297
Hsp92II CATG 2 cut(s) 98, 130
Kzo9I GATC 1 cut(s) 235
LpnPI CCDG 3 cut(s) 75, 114, 278
Lsp1109I GCAGC 4 cut(s) 74, 121, 166, 178
LweI GCATC 1 cut(s) 211
MaeI CTAG 1 cut(s) 53
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 3 cut(s) 82, 201, 268
MflI RGATCY 1 cut(s) 235
MlsI TGGCCA 1 cut(s) 146
MluCI AATT 2 cut(s) 15, 29
MluNI TGGCCA 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 198
MnlI CCTC 5 cut(s) 13, 102, 169, 226, 276
Mox20I TGGCCA 1 cut(s) 146
MscI TGGCCA 1 cut(s) 146
MseI TTAA 2 cut(s) 228, 270
Msp20I TGGCCA 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 293
MvaI CCWGG 1 cut(s) 293
MwoI GCNNNNNNNGC 1 cut(s) 143
NdeII GATC 1 cut(s) 235
NlaIII CATG 2 cut(s) 98, 130
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 4 cut(s) 89, 136, 168, 181
PshBI ATTAAT 1 cut(s) 228
Psp6I CCWGG 1 cut(s) 291
PspGI CCWGG 1 cut(s) 291
PsuI RGATCY 1 cut(s) 235
SaqAI TTAA 2 cut(s) 228, 270
SatI GCNGC 4 cut(s) 88, 135, 167, 180
Sau3AI GATC 1 cut(s) 235
ScrFI CCNGG 1 cut(s) 293
SetI ASST 2 cut(s) 24, 171
SfaNI GCATC 1 cut(s) 211
SgeI CNNG 7 cut(s) 65, 74, 91, 107, 113, 139, 154
Sse9I AATT 2 cut(s) 15, 29
SsiI CCGC 2 cut(s) 115, 212
SspMI CTAG 1 cut(s) 53
StyD4I CCNGG 1 cut(s) 291
TasI AATT 2 cut(s) 15, 29
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 228, 270
Tru9I TTAA 2 cut(s) 228, 270
TscAI CASTG 1 cut(s) 166
TseI GCWGC 4 cut(s) 87, 134, 166, 179
TspDTI ATGAA 2 cut(s) 143, 269
TspRI CASTG 1 cut(s) 166
VspI ATTAAT 1 cut(s) 228
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.