Rh7AG401100

Proteinase inhibitor type-2 CEVI57-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0006762
Physical Location & Seq
Reverse (-)
52763599 .. 52764490
892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG401100.1

Sequence Viewer

Length: 240 bp
ATGGCTAGAGACAAGAGTATGGGTGCAATAGTTCTTCTCCTTATTTGTGGTTCAATCCTACTGGGTATGAATCCAACTGAGGCCAAAGTTTGCATTCAAATTTGCTACGAGGCAGCTTATATGACTTGCCCGTCTTCAGGCTCTACGCATCTTTCGCCATCTTGCAACTGTTGCTTAGCTCCGGAGGTCGGCTGCAAAATTTACAACTCTGACGGAACTCAAATCTGTACTAGTACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Prot_inhib_II

Protein Analysis

79

Amino Acids

8.28

Weight (kDa)

5.54

Isoelectric Point (pI)

41.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prot_inhib_II PF02428 29 - 77 4.5e-14 Potato type II proteinase inhibitor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 130
AccIII TCCGGA 1 cut(s) 181
AcsI RAATTY 2 cut(s) 99, 198
AcuI CTGAAG 1 cut(s) 120
AfaI GTAC 2 cut(s) 229, 235
AfiI CCNNNNNNNGG 2 cut(s) 137, 188
AgsI TTSAA 2 cut(s) 54, 98
AhlI ACTAGT 1 cut(s) 230
AluBI AGCT 2 cut(s) 116, 179
AluI AGCT 2 cut(s) 116, 179
Alw26I GTCTC 1 cut(s) 3
Aor13HI TCCGGA 1 cut(s) 181
AoxI GGCC 1 cut(s) 81
ApeKI GCWGC 2 cut(s) 113, 192
ApoI RAATTY 2 cut(s) 99, 198
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 2 cut(s) 125, 179
BccI CCATC 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 3
BcuI ACTAGT 1 cut(s) 230
BfaI CTAG 2 cut(s) 6, 231
BisI GCNGC 2 cut(s) 114, 193
BlpI GCTNAGC 1 cut(s) 175
BlsI GCNGC 2 cut(s) 115, 194
BmcAI AGTACT 1 cut(s) 235
BmrI ACTGGG 1 cut(s) 71
BmsI GCATC 1 cut(s) 157
BmuI ACTGGG 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 126
Bpu1102I GCTNAGC 1 cut(s) 175
BsaWI WCCGGW 1 cut(s) 181
Bsc4I CCNNNNNNNGG 2 cut(s) 137, 188
Bse1I ACTGG 1 cut(s) 66
BseAI TCCGGA 1 cut(s) 181
BseLI CCNNNNNNNGG 2 cut(s) 137, 188
BseMII CTCAG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 66
BseXI GCAGC 2 cut(s) 125, 179
BshFI GGCC 1 cut(s) 83
BsiSI CCGG 1 cut(s) 182
BslI CCNNNNNNNGG 2 cut(s) 137, 188
BsmAI GTCTC 1 cut(s) 3
BsmI GAATGC 1 cut(s) 93
BsnI GGCC 1 cut(s) 83
Bsp13I TCCGGA 1 cut(s) 181
Bsp1720I GCTNAGC 1 cut(s) 175
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 70
BspEI TCCGGA 1 cut(s) 181
BsrI ACTGG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 170
BstAPI GCANNNNNTGC 1 cut(s) 171
BstDEI CTNAG 2 cut(s) 78, 175
BstMAI GTCTC 1 cut(s) 3
BstMWI GCNNNNNNNGC 2 cut(s) 154, 171
BstV1I GCAGC 2 cut(s) 125, 179
BstV2I GAAGAC 1 cut(s) 126
BsuRI GGCC 1 cut(s) 83
Csp6I GTAC 2 cut(s) 228, 234
CviJI RGCY 6 cut(s) 5, 83, 116, 141, 179, 192
CviKI_1 RGCY 6 cut(s) 5, 83, 116, 141, 179, 192
CviQI GTAC 2 cut(s) 228, 234
DdeI CTNAG 2 cut(s) 78, 175
DrdI GACNNNNNNGTC 1 cut(s) 130
DseDI GACNNNNNNGTC 1 cut(s) 130
Eco57I CTGAAG 1 cut(s) 120
FaiI YATR 4 cut(s) 20, 68, 120, 122
Fnu4HI GCNGC 2 cut(s) 114, 193
Fsp4HI GCNGC 2 cut(s) 114, 193
FspBI CTAG 2 cut(s) 6, 231
GluI GCNGC 2 cut(s) 114, 193
HaeIII GGCC 1 cut(s) 83
HapII CCGG 1 cut(s) 182
HinfI GANTC 1 cut(s) 70
HpaII CCGG 1 cut(s) 182
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4V TGCA 4 cut(s) 26, 93, 165, 195
HpyF10VI GCNNNNNNNGC 2 cut(s) 154, 171
HpyF3I CTNAG 2 cut(s) 78, 175
Kpn2I TCCGGA 1 cut(s) 181
LmnI GCTCC 1 cut(s) 184
LpnPI CCDG 3 cut(s) 47, 123, 195
Lsp1109I GCAGC 2 cut(s) 125, 179
LweI GCATC 1 cut(s) 157
MaeI CTAG 2 cut(s) 6, 231
MboII GAAGA 2 cut(s) 26, 126
MluCI AATT 2 cut(s) 99, 198
MmeI TCCRAC 1 cut(s) 98
MnlI CCTC 3 cut(s) 73, 103, 178
MroI TCCGGA 1 cut(s) 181
MspI CCGG 1 cut(s) 182
Mva1269I GAATGC 1 cut(s) 93
MwoI GCNNNNNNNGC 2 cut(s) 154, 171
PctI GAATGC 1 cut(s) 93
PfeI GAWTC 1 cut(s) 70
PkrI GCNGC 2 cut(s) 115, 194
RsaI GTAC 2 cut(s) 229, 235
RsaNI GTAC 2 cut(s) 228, 234
SatI GCNGC 2 cut(s) 114, 193
ScaI AGTACT 1 cut(s) 235
SetI ASST 3 cut(s) 118, 181, 189
SfaNI GCATC 1 cut(s) 157
SgeI CNNG 9 cut(s) 18, 25, 74, 121, 138, 142, 150, 174, 194
SpeI ACTAGT 1 cut(s) 230
Sse9I AATT 2 cut(s) 99, 198
SspMI CTAG 2 cut(s) 6, 231
TaaI ACNGT 1 cut(s) 170
TasI AATT 2 cut(s) 99, 198
TatI WGTACW 2 cut(s) 227, 233
TfiI GAWTC 1 cut(s) 70
TseI GCWGC 2 cut(s) 113, 192
TspDTI ATGAA 1 cut(s) 83
TspGWI ACGGA 1 cut(s) 228
XapI RAATTY 2 cut(s) 99, 198
XspI CTAG 2 cut(s) 6, 231
ZrmI AGTACT 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.