Rh7BG305100

DNA polymerase III, delta subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0008140
Physical Location & Seq
Reverse (-)
29027927 .. 29028244
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG305100.1

Sequence Viewer

Length: 318 bp
ATGGAGTTGCATAGCCTAACCCACAGCAGGTACTTGGTGAACCACATTGCCATCAGCAACACTGCTGAGCAACAAGAGATGGACAATACGAAACAAAAGTCTACCATCAAAAGCATTACGAAACAGACAAATTGCAGAGACAAGGCAGTTGATGGAGAGACCCACTTTACTTGCATCAGTGAAATGGAAGAAATTTGGCTAAACATGTTGGGCAGGATGCATAGTTCATATTTGAAAGACTTTTTGTGCCACAAAGTGAAGCTTGCATCATTAACTATAACTAGTGGTAAAGCACTTTTACTCTACACTAGCATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DNA_pol3_delta2 DNA_pol3_gamma3

Protein Analysis

105

Amino Acids

12.0

Weight (kDa)

7.78

Isoelectric Point (pI)

32.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaA_N-like_STI PF23007 60 - 98 1.7e-07 STICHEL, DnaA_N-like alpha-beta domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 18
AccI GTMKAC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 192
AdeI CACNNNGTG 1 cut(s) 256
AfaI GTAC 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 27
AflIII ACRYGT 1 cut(s) 204
AgsI TTSAA 1 cut(s) 235
AhlI ACTAGT 1 cut(s) 281
AloI GAACNNNNNNTCC 2 cut(s) 208, 240
AluBI AGCT 1 cut(s) 262
AluI AGCT 1 cut(s) 262
Alw26I GTCTC 2 cut(s) 132, 152
ApoI RAATTY 1 cut(s) 192
ArsI GACNNNNNNTTYG 2 cut(s) 83, 115
AsuHPI GGTGA 1 cut(s) 49
BccI CCATC 4 cut(s) 59, 73, 113, 146
BcoDI GTCTC 2 cut(s) 132, 152
BcuI ACTAGT 1 cut(s) 281
BfaI CTAG 2 cut(s) 282, 309
BfuAI ACCTGC 1 cut(s) 18
BlpI GCTNAGC 1 cut(s) 66
BmsI GCATC 3 cut(s) 183, 207, 275
Bpu1102I GCTNAGC 1 cut(s) 66
BsaI GGTCTC 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 27
Bse3DI GCAATG 1 cut(s) 45
BseGI GGATG 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 27
BseMI GCAATG 1 cut(s) 45
BseMII CTCAG 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 27
BsmAI GTCTC 2 cut(s) 132, 152
Bso31I GGTCTC 1 cut(s) 152
Bsp1720I GCTNAGC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 58
BspMI ACCTGC 1 cut(s) 18
BspTNI GGTCTC 1 cut(s) 152
BsrDI GCAATG 1 cut(s) 45
BstC8I GCNNGC 1 cut(s) 264
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 222
BstMAI GTCTC 2 cut(s) 132, 152
BstNSI RCATGY 1 cut(s) 208
BtsCI GGATG 1 cut(s) 222
BtsI GCAGTG 1 cut(s) 60
BtsIMutI CAGTG 2 cut(s) 60, 184
BveI ACCTGC 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 264
Csp6I GTAC 1 cut(s) 31
CspCI CAANNNNNGTGG 2 cut(s) 152, 187
CviAII CATG 1 cut(s) 205
CviJI RGCY 3 cut(s) 15, 199, 262
CviKI_1 RGCY 3 cut(s) 15, 199, 262
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 1 cut(s) 66
DraIII CACNNNGTG 1 cut(s) 256
Eco31I GGTCTC 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 222
FaeI CATG 1 cut(s) 208
FaiI YATR 7 cut(s) 12, 206, 222, 229, 278, 314, 316
FalI AAGNNNNNCTT 2 cut(s) 246, 278
FatI CATG 1 cut(s) 204
FblI GTMKAC 1 cut(s) 101
FokI GGATG 1 cut(s) 229
FspBI CTAG 2 cut(s) 282, 309
Hin1II CATG 1 cut(s) 208
HindIII AAGCTT 1 cut(s) 260
HphI GGTGA 1 cut(s) 49
Hpy166II GTNNAC 2 cut(s) 40, 102
Hpy8I GTNNAC 2 cut(s) 40, 102
HpyCH4V TGCA 5 cut(s) 10, 135, 174, 220, 266
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 1 cut(s) 208
LpnPI CCDG 2 cut(s) 13, 199
LweI GCATC 3 cut(s) 183, 207, 275
MaeI CTAG 2 cut(s) 282, 309
MboII GAAGA 1 cut(s) 200
MluCI AATT 2 cut(s) 130, 192
Mph1103I ATGCAT 1 cut(s) 222
MseI TTAA 1 cut(s) 272
NlaIII CATG 1 cut(s) 208
NsiI ATGCAT 1 cut(s) 222
NspI RCATGY 1 cut(s) 208
PciI ACATGT 1 cut(s) 204
PscI ACATGT 1 cut(s) 204
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
SaqAI TTAA 1 cut(s) 272
SetI ASST 2 cut(s) 32, 264
SfaNI GCATC 3 cut(s) 183, 207, 275
SgeI CNNG 9 cut(s) 40, 46, 86, 154, 183, 217, 226, 275, 294
SpeI ACTAGT 1 cut(s) 281
Sse9I AATT 2 cut(s) 130, 192
SspMI CTAG 2 cut(s) 282, 309
TasI AATT 2 cut(s) 130, 192
Tru1I TTAA 1 cut(s) 272
Tru9I TTAA 1 cut(s) 272
TscAI CASTG 2 cut(s) 67, 184
TspDTI ATGAA 1 cut(s) 216
TspRI CASTG 2 cut(s) 67, 184
XapI RAATTY 1 cut(s) 192
XceI RCATGY 1 cut(s) 208
XmiI GTMKAC 1 cut(s) 101
XspI CTAG 2 cut(s) 282, 309
Zsp2I ATGCAT 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.