Rw5G015170

DNA repair protein recA homolog 1

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
18437066 .. 18438103
1038 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G015170.1

Sequence Viewer

Length: 252 bp
ATGGCGAAATGGCACTTGATCGAGACTGGATGTACTCTCATATTCTTGAATCAAATAAGATATAAGATTGGTGTGTATTATGGGAATCCAGAAGTGACATCTAGAGGAATTGCATTAAAGTTCTTTGCCTCAGTTCGCCTGGAAATACGTTCTACAGGGAAAATAAAATCTGTAAAAGGAGACGAGGAAATTGGGGTTCAGGTCCGTGTACGAGTGCAAAAGAGTAAGGTACTTTTAAAAACATCAGAATAA

Protein Analysis

83

Amino Acids

9.43

Weight (kDa)

10.0

Isoelectric Point (pI)

25.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RecA_N PF00154 6 - 77 4.5e-22 RecA N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 34, 210, 231
AgsI TTSAA 1 cut(s) 49
AjnI CCWGG 1 cut(s) 138
Alw26I GTCTC 2 cut(s) 17, 174
AspS9I GGNCC 1 cut(s) 202
AvaII GGWCC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 140
BcoDI GTCTC 2 cut(s) 17, 174
BfaI CTAG 1 cut(s) 102
BfmI CTRYAG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 140
Bse1I ACTGG 1 cut(s) 31
BseBI CCWGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 31
BsmAI GTCTC 2 cut(s) 17, 174
BsmBI CGTCTC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 143
BsrI ACTGG 1 cut(s) 31
BssMI GATC 1 cut(s) 18
Bst2UI CCWGG 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 130
BstF5I GGATG 1 cut(s) 35
BstKTI GATC 1 cut(s) 21
BstMAI GTCTC 2 cut(s) 17, 174
BstMBI GATC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BstSFI CTRYAG 1 cut(s) 153
BtsCI GGATG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 202
Csp6I GTAC 3 cut(s) 33, 209, 230
CviQI GTAC 3 cut(s) 33, 209, 230
DdeI CTNAG 1 cut(s) 130
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
DraI TTTAAA 1 cut(s) 237
Eco47I GGWCC 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 138
Esp3I CGTCTC 1 cut(s) 174
FaiI YATR 3 cut(s) 41, 63, 81
FokI GGATG 1 cut(s) 42
FspBI CTAG 1 cut(s) 102
HinfI GANTC 2 cut(s) 49, 85
Hpy166II GTNNAC 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 247
Hpy188III TCNNGA 4 cut(s) 22, 46, 89, 102
Hpy8I GTNNAC 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 148
HpyCH4V TGCA 2 cut(s) 113, 217
HpyF3I CTNAG 1 cut(s) 130
HpySE526I ACGT 1 cut(s) 148
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 6 cut(s) 12, 102, 125, 141, 152, 185
MaeI CTAG 1 cut(s) 102
MaeII ACGT 1 cut(s) 148
MaeIII GTNAC 1 cut(s) 94
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MluCI AATT 2 cut(s) 108, 189
MnlI CCTC 3 cut(s) 98, 139, 178
MseI TTAA 2 cut(s) 116, 236
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
NdeII GATC 1 cut(s) 18
NmuCI GTSAC 1 cut(s) 94
PfeI GAWTC 2 cut(s) 49, 85
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspPI GGNCC 1 cut(s) 202
RsaI GTAC 3 cut(s) 34, 210, 231
RsaNI GTAC 3 cut(s) 33, 209, 230
SaqAI TTAA 2 cut(s) 116, 236
Sau3AI GATC 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 140
SetI ASST 3 cut(s) 151, 204, 231
SfcI CTRYAG 1 cut(s) 153
SinI GGWCC 1 cut(s) 202
Sse9I AATT 2 cut(s) 108, 189
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 138
TaiI ACGT 1 cut(s) 151
TaqI TCGA 1 cut(s) 21
TasI AATT 2 cut(s) 108, 189
TatI WGTACW 1 cut(s) 32
TfiI GAWTC 2 cut(s) 49, 85
Tru1I TTAA 2 cut(s) 116, 236
Tru9I TTAA 2 cut(s) 116, 236
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspGWI ACGGA 1 cut(s) 194
VpaK11BI GGWCC 1 cut(s) 202
XbaI TCTAGA 1 cut(s) 101
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.