AT1G33607

Cysteine-rich antifungal protein 2, defensin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0009981
Physical Location & Seq
Reverse (-)
12186941 .. 12187423
483 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G33607.1

Sequence Viewer

Length: 246 bp
ATGGCTAGTTTGAAAGTTTTTTCTTTTGCTTTGCTCATTGTTCTCACTTTCTCAGTTATTGGTATGATATATAATGTAGAGAGTGGTGGTTCTTTGTGTTGTAATAGCCACCCAAAATTTGGAAAGTGCAACACAAACAATGACGAGCAGAGATGCAACCGTTGGTGTCACAATGGATGCGGCAATGGAAAAGGCGGTTACTACAAATCTATGTCTCACGGGGGACAATGCCACTATTATTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

81

Amino Acids

8.94

Weight (kDa)

8.68

Isoelectric Point (pI)

36.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 32 - 81 1.7e-15 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 119
AciI CCGC 2 cut(s) 180, 195
AcsI RAATTY 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 13
Alw26I GTCTC 1 cut(s) 219
ApoI RAATTY 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 219
BfaI CTAG 1 cut(s) 6
BisI GCNGC 1 cut(s) 181
BlsI GCNGC 1 cut(s) 182
BmsI GCATC 2 cut(s) 143, 167
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse3DI GCAATG 1 cut(s) 190
BseGI GGATG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 190
BseMII CTCAG 1 cut(s) 66
BslFI GGGAC 1 cut(s) 237
BslI CCNNNNNNNGG 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 219
BsmFI GGGAC 1 cut(s) 237
BspACI CCGC 2 cut(s) 180, 195
BspCNI CTCAG 1 cut(s) 65
BsrDI GCAATG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 161
BstDEI CTNAG 1 cut(s) 52
BstF5I GGATG 1 cut(s) 182
BstMAI GTCTC 1 cut(s) 219
BtsCI GGATG 1 cut(s) 182
CspCI CAANNNNNGTGG 1 cut(s) 221
CviJI RGCY 2 cut(s) 5, 108
CviKI_1 RGCY 2 cut(s) 5, 108
DdeI CTNAG 1 cut(s) 52
FaiI YATR 4 cut(s) 65, 70, 72, 212
FaqI GGGAC 1 cut(s) 237
Fnu4HI GCNGC 1 cut(s) 181
FokI GGATG 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 181
FspBI CTAG 1 cut(s) 6
GluI GCNGC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4V TGCA 2 cut(s) 129, 156
HpyF3I CTNAG 1 cut(s) 52
LweI GCATC 2 cut(s) 143, 167
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 2 cut(s) 167, 197
MluCI AATT 1 cut(s) 116
MseI TTAA 1 cut(s) 244
NmuCI GTSAC 1 cut(s) 167
PflMI CCANNNNNTGG 1 cut(s) 119
PkrI GCNGC 1 cut(s) 182
SaqAI TTAA 1 cut(s) 244
SatI GCNGC 1 cut(s) 181
SfaNI GCATC 2 cut(s) 143, 167
SgeI CNNG 4 cut(s) 18, 157, 230, 232
Sse9I AATT 1 cut(s) 116
SsiI CCGC 2 cut(s) 180, 195
SspMI CTAG 1 cut(s) 6
TaaI ACNGT 1 cut(s) 161
TasI AATT 1 cut(s) 116
TauI GCSGC 1 cut(s) 183
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
Van91I CCANNNNNTGG 1 cut(s) 119
XapI RAATTY 1 cut(s) 116
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.