Prupe.6G206000_v2.0.a1

Cysteine-rich antifungal protein 2, defensin-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
21424501 .. 21424704
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G206000.1

Sequence Viewer

Length: 204 bp
ATTGCAACTGTTGAAGGGTCTAAGTGTTGTACTGATCATCCTGAACTTGGAAATTGTGTCCCTGGTGCGGATGACAACCCAAACGGTGGAAAATGCTGGACATTTTGCACTTCAGATTGTGAGAAAGGAGGAATCTGCAAACTATTTGGCGACCGTCATCATTGCCATTGCTTATGTTGGTTTTTTTTCAACCCTATTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.33

Weight (kDa)

5.66

Isoelectric Point (pI)

30.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 86
AciI CCGC 1 cut(s) 68
AcuI CTGAAG 1 cut(s) 96
AfaI GTAC 1 cut(s) 31
AfiI CCNNNNNNNGG 3 cut(s) 47, 67, 86
AgsI TTSAA 2 cut(s) 14, 190
AjnI CCWGG 1 cut(s) 61
BciT130I CCWGG 1 cut(s) 63
BclI TGATCA 1 cut(s) 34
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BsaJI CCNNGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 3 cut(s) 47, 67, 86
Bse3DI GCAATG 2 cut(s) 160, 166
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 2 cut(s) 37, 76
BseLI CCNNNNNNNGG 3 cut(s) 47, 67, 86
BseMI GCAATG 2 cut(s) 160, 166
Bsh1285I CGRYCG 1 cut(s) 154
BsiEI CGRYCG 1 cut(s) 154
BslFI GGGAC 1 cut(s) 44
BslI CCNNNNNNNGG 3 cut(s) 47, 67, 86
BsmFI GGGAC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 68
BsrDI GCAATG 2 cut(s) 160, 166
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 3 cut(s) 10, 86, 155
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 2 cut(s) 37, 76
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMCI CGRYCG 1 cut(s) 154
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BtsCI GGATG 2 cut(s) 37, 76
Csp6I GTAC 1 cut(s) 30
CviQI GTAC 1 cut(s) 30
DdeI CTNAG 1 cut(s) 21
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 96
EcoRII CCWGG 1 cut(s) 61
FaiI YATR 2 cut(s) 175, 202
FaqI GGGAC 1 cut(s) 44
FbaI TGATCA 1 cut(s) 34
FokI GGATG 2 cut(s) 24, 83
HinfI GANTC 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 41
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 3 cut(s) 10, 86, 155
HpyCH4V TGCA 3 cut(s) 5, 108, 138
HpyF3I CTNAG 1 cut(s) 21
Ksp22I TGATCA 1 cut(s) 34
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 4 cut(s) 48, 54, 75, 82
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MluCI AATT 1 cut(s) 52
MnlI CCTC 1 cut(s) 122
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
NdeII GATC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 132
PflMI CCANNNNNTGG 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
Sau3AI GATC 1 cut(s) 34
ScrFI CCNGG 1 cut(s) 63
SgeI CNNG 5 cut(s) 53, 59, 74, 75, 109
Sse9I AATT 1 cut(s) 52
SsiI CCGC 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 3 cut(s) 10, 86, 155
TasI AATT 1 cut(s) 52
TatI WGTACW 1 cut(s) 29
TfiI GAWTC 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.