AT5G52605

Defensin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0009981
Physical Location & Seq
Reverse (-)
21345216 .. 21345600
385 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G52605.1

Sequence Viewer

Length: 273 bp
ATGGTTAGAACAAATGTTGTCTCTTTTGTTTTATTTGCTGCTATTGTATTATGTATACTATATGGACAAAAACACATCGCACCCTGGATATTTGAAGACAAATCGATATGTTGTAAAGAACATCCGAGTGTTGGAAGGTGTCTTCCAGGCATCGATGATGATGCTGAGAAGGATGGGAAATGCTGGAAATTTTGTATTGAAGGGTGCGAAACAGGAGGTTTTTGCAAACTTTTTGAACATAAACATATATGTCATTGCAATTGTTCCGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

90

Amino Acids

10.08

Weight (kDa)

6.48

Isoelectric Point (pI)

35.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 36 - 88 1.6e-15 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 55
AcsI RAATTY 1 cut(s) 188
AfiI CCNNNNNNNGG 1 cut(s) 131
AgsI TTSAA 3 cut(s) 95, 200, 236
AjnI CCWGG 2 cut(s) 83, 145
Alw26I GTCTC 1 cut(s) 25
ApeKI GCWGC 1 cut(s) 38
ApoI RAATTY 1 cut(s) 188
BbsI GAAGAC 2 cut(s) 102, 134
BbvI GCAGC 1 cut(s) 25
BccI CCATC 1 cut(s) 167
BcgI CGANNNNNNTGC 2 cut(s) 143, 177
BciT130I CCWGG 2 cut(s) 85, 147
BcoDI GTCTC 1 cut(s) 25
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
Bme1390I CCNGG 2 cut(s) 85, 147
BmrFI CCNGG 2 cut(s) 85, 147
BmsI GCATC 2 cut(s) 151, 159
BpiI GAAGAC 2 cut(s) 102, 134
Bsa29I ATCGAT 2 cut(s) 104, 153
BsaJI CCNNGG 1 cut(s) 83
BsaWI WCCGGW 1 cut(s) 266
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse3DI GCAATG 1 cut(s) 253
BseBI CCWGG 2 cut(s) 85, 147
BseCI ATCGAT 2 cut(s) 104, 153
BseDI CCNNGG 1 cut(s) 83
BseGI GGATG 2 cut(s) 121, 178
BseLI CCNNNNNNNGG 1 cut(s) 131
BseMI GCAATG 1 cut(s) 253
BseMII CTCAG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 25
BshVI ATCGAT 2 cut(s) 104, 153
BsiSI CCGG 1 cut(s) 267
BslI CCNNNNNNNGG 1 cut(s) 131
BsmAI GTCTC 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 157
BspDI ATCGAT 2 cut(s) 104, 153
BsrDI GCAATG 1 cut(s) 253
BssECI CCNNGG 1 cut(s) 83
BssNAI GTATAC 1 cut(s) 56
Bst1107I GTATAC 1 cut(s) 56
Bst2UI CCWGG 2 cut(s) 85, 147
BstDEI CTNAG 1 cut(s) 165
BstF5I GGATG 2 cut(s) 121, 178
BstMAI GTCTC 1 cut(s) 25
BstNI CCWGG 2 cut(s) 85, 147
BstSCI CCNGG 2 cut(s) 83, 145
BstV1I GCAGC 1 cut(s) 25
BstV2I GAAGAC 2 cut(s) 102, 134
BstZ17I GTATAC 1 cut(s) 56
Bsu15I ATCGAT 2 cut(s) 104, 153
BsuTUI ATCGAT 2 cut(s) 104, 153
BtgZI GCGATG 1 cut(s) 61
BtsCI GGATG 2 cut(s) 121, 178
ClaI ATCGAT 2 cut(s) 104, 153
DdeI CTNAG 1 cut(s) 165
EcoRII CCWGG 2 cut(s) 83, 145
FaiI YATR 9 cut(s) 52, 56, 61, 63, 109, 240, 246, 248, 250
FblI GTMKAC 1 cut(s) 55
Fnu4HI GCNGC 1 cut(s) 39
FokI GGATG 2 cut(s) 108, 185
Fsp4HI GCNGC 1 cut(s) 39
GluI GCNGC 1 cut(s) 39
HapII CCGG 1 cut(s) 267
HpaII CCGG 1 cut(s) 267
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 126
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 3 cut(s) 129, 163, 194
HpyCH4V TGCA 2 cut(s) 225, 258
HpyF3I CTNAG 1 cut(s) 165
LpnPI CCDG 6 cut(s) 70, 97, 132, 159, 169, 198
Lsp1109I GCAGC 1 cut(s) 25
LweI GCATC 2 cut(s) 151, 159
MboII GAAGA 2 cut(s) 107, 134
MfeI CAATTG 1 cut(s) 259
MluCI AATT 2 cut(s) 188, 259
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 1 cut(s) 209
MseI TTAA 1 cut(s) 271
MslI CAYNNNNRTG 1 cut(s) 126
MspI CCGG 1 cut(s) 267
MspR9I CCNGG 2 cut(s) 85, 147
MunI CAATTG 1 cut(s) 259
MvaI CCWGG 2 cut(s) 85, 147
PkrI GCNGC 1 cut(s) 40
Psp6I CCWGG 2 cut(s) 83, 145
PspGI CCWGG 2 cut(s) 83, 145
RseI CAYNNNNRTG 1 cut(s) 126
SaqAI TTAA 1 cut(s) 271
SatI GCNGC 1 cut(s) 39
ScrFI CCNGG 2 cut(s) 85, 147
SetI ASST 2 cut(s) 140, 220
SfaNI GCATC 2 cut(s) 151, 159
SgeI CNNG 7 cut(s) 96, 97, 138, 158, 159, 196, 225
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 2 cut(s) 188, 259
StyD4I CCNGG 2 cut(s) 83, 145
TaqI TCGA 2 cut(s) 104, 153
TasI AATT 2 cut(s) 188, 259
Tru1I TTAA 1 cut(s) 271
Tru9I TTAA 1 cut(s) 271
TseI GCWGC 1 cut(s) 38
XapI RAATTY 1 cut(s) 188
XmiI GTMKAC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.