FvH4_1g19000

Defensin-like protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
11260656 .. 11261299
644 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g19000.t1

Sequence Viewer

Length: 240 bp
ATGGCCAAGATGACTAAGTTTACTATTGCTTCCTTTTTCCTTGTCATGCTTTTGTTGAGCACAGCAAGTGCTCAATCAAAGTGTTGCGCCAATCATCCCAAGGTCGGAAGTTGTGTGCCTGGCAAAGATGATGACCCTAATCAAGATGGAAAATGCTGGGTGTTTTGCGTCTCAGACTGTACTAAAGGAGGATTCTGCAAACAAGTTGGCTCTGGCCACGTGTGTCATTGCTATTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.47

Weight (kDa)

8.36

Isoelectric Point (pI)

33.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 27 - 79 4.6e-14 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 3, 214
AcvI CACGTG 1 cut(s) 220
AfaI GTAC 1 cut(s) 181
AfiI CCNNNNNNNGG 1 cut(s) 104
AflIII ACRYGT 1 cut(s) 219
AjnI CCWGG 1 cut(s) 118
Alw21I GWGCWC 2 cut(s) 62, 73
Alw26I GTCTC 1 cut(s) 175
AoxI GGCC 2 cut(s) 3, 214
AspLEI GCGC 1 cut(s) 89
BalI TGGCCA 2 cut(s) 5, 216
BbrPI CACGTG 1 cut(s) 220
Bbv12I GWGCWC 2 cut(s) 62, 73
BccI CCATC 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BsaAI YACGTR 1 cut(s) 220
BsaJI CCNNGG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 226
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 99
BseGI GGATG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 226
BseMII CTCAG 1 cut(s) 186
BseYI CCCAGC 1 cut(s) 156
BshFI GGCC 2 cut(s) 5, 216
BsiHKAI GWGCWC 2 cut(s) 62, 73
BslI CCNNNNNNNGG 1 cut(s) 104
BsmAI GTCTC 1 cut(s) 175
BsmBI CGTCTC 1 cut(s) 175
BsnI GGCC 2 cut(s) 5, 216
Bsp1286I GDGCHC 2 cut(s) 62, 73
BspANI GGCC 2 cut(s) 5, 216
BspCNI CTCAG 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 226
BssECI CCNNGG 1 cut(s) 99
BssT1I CCWWGG 1 cut(s) 99
Bst2UI CCWGG 1 cut(s) 120
Bst4CI ACNGT 1 cut(s) 179
BstBAI YACGTR 1 cut(s) 220
BstDEI CTNAG 2 cut(s) 15, 172
BstF5I GGATG 1 cut(s) 94
BstHHI GCGC 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BsuRI GGCC 2 cut(s) 5, 216
BtsCI GGATG 1 cut(s) 94
CfoI GCGC 1 cut(s) 89
CseI GACGC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 180
CviAII CATG 1 cut(s) 46
CviJI RGCY 3 cut(s) 5, 210, 216
CviKI_1 RGCY 3 cut(s) 5, 210, 216
CviQI GTAC 1 cut(s) 180
DdeI CTNAG 2 cut(s) 15, 172
EaeI YGGCCR 2 cut(s) 3, 214
Eco130I CCWWGG 1 cut(s) 99
Eco72I CACGTG 1 cut(s) 220
EcoRII CCWGG 1 cut(s) 118
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
Esp3I CGTCTC 1 cut(s) 175
FaeI CATG 1 cut(s) 49
FaiI YATR 1 cut(s) 47
FatI CATG 1 cut(s) 45
FokI GGATG 1 cut(s) 81
GlaI GCGC 1 cut(s) 88
GsaI CCCAGC 1 cut(s) 160
HaeIII GGCC 2 cut(s) 5, 216
HgaI GACGC 1 cut(s) 157
HhaI GCGC 1 cut(s) 89
Hin1II CATG 1 cut(s) 49
Hin6I GCGC 1 cut(s) 87
HinP1I GCGC 1 cut(s) 87
HinfI GANTC 1 cut(s) 192
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 2 cut(s) 107, 175
Hpy188III TCNNGA 1 cut(s) 143
Hpy8I GTNNAC 1 cut(s) 21
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4IV ACGT 1 cut(s) 219
HpyCH4V TGCA 1 cut(s) 198
HpyF3I CTNAG 2 cut(s) 15, 172
HpySE526I ACGT 1 cut(s) 219
Hsp92II CATG 1 cut(s) 49
HspAI GCGC 1 cut(s) 87
LpnPI CCDG 4 cut(s) 105, 132, 142, 198
MaeII ACGT 1 cut(s) 219
MhlI GDGCHC 2 cut(s) 62, 73
MlsI TGGCCA 2 cut(s) 5, 216
MluNI TGGCCA 2 cut(s) 5, 216
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 1 cut(s) 182
Mox20I TGGCCA 2 cut(s) 5, 216
MscI TGGCCA 2 cut(s) 5, 216
Msp20I TGGCCA 2 cut(s) 5, 216
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
NlaIII CATG 1 cut(s) 49
PfeI GAWTC 1 cut(s) 192
PmaCI CACGTG 1 cut(s) 220
PmlI CACGTG 1 cut(s) 220
Ppu21I YACGTR 1 cut(s) 220
Psp6I CCWGG 1 cut(s) 118
PspCI CACGTG 1 cut(s) 220
PspFI CCCAGC 1 cut(s) 156
PspGI CCWGG 1 cut(s) 118
RsaI GTAC 1 cut(s) 181
RsaNI GTAC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 120
SduI GDGCHC 2 cut(s) 62, 73
SetI ASST 2 cut(s) 105, 222
StyD4I CCNGG 1 cut(s) 118
StyI CCWWGG 1 cut(s) 99
TaaI ACNGT 1 cut(s) 179
TaiI ACGT 1 cut(s) 222
TatI WGTACW 1 cut(s) 179
TfiI GAWTC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.