AT4G18823

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0009981
Physical Location & Seq
Reverse (-)
10334911 .. 10335282
372 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G18823.1

Sequence Viewer

Length: 225 bp
ATGGTCCATCCAAGATTTGTTTTCTTCGCTTTCCTCGCTCTCTCCGTTTTACTTGCAGTGATGAATGAAGATTCAATTTTGTCTTCCAACAAAGGAGATTCATTGTGTTGCAACGATCACCCCGAATTTGGAATATGTACTAATAAAAGTTGTAACAAGTGGTGTCTTCAAGGCTGTACGAGAGGTGGCTTCTGTAAAAGAAAAATTTGTCATTGCTACTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

74

Amino Acids

8.31

Weight (kDa)

8.37

Isoelectric Point (pI)

57.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 35 - 74 2.2e-12 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 125, 204
AfaI GTAC 2 cut(s) 139, 178
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 2 cut(s) 75, 170
ApoI RAATTY 2 cut(s) 125, 204
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 110
AvaII GGWCC 1 cut(s) 4
BbsI GAAGAC 2 cut(s) 75, 158
BccI CCATC 1 cut(s) 15
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BpiI GAAGAC 2 cut(s) 75, 158
Bsc4I CCNNNNNNNGG 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 211
BseGI GGATG 1 cut(s) 7
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMI GCAATG 1 cut(s) 211
BslI CCNNNNNNNGG 1 cut(s) 128
Bsp143I GATC 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 211
BssMI GATC 1 cut(s) 115
Bst4CI ACNGT 1 cut(s) 221
BstF5I GGATG 1 cut(s) 7
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstV2I GAAGAC 2 cut(s) 75, 158
BtsCI GGATG 1 cut(s) 7
BtsI GCAGTG 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 2 cut(s) 138, 177
CviJI RGCY 2 cut(s) 174, 189
CviKI_1 RGCY 2 cut(s) 174, 189
CviQI GTAC 2 cut(s) 138, 177
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 4
FaiI YATR 1 cut(s) 136
HinfI GANTC 2 cut(s) 71, 98
HphI GGTGA 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 221
HpyCH4V TGCA 2 cut(s) 56, 111
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
Kzo9I GATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 152
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 4 cut(s) 16, 75, 80, 158
MluCI AATT 3 cut(s) 75, 125, 204
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 2 cut(s) 44, 176
MseI TTAA 1 cut(s) 223
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 1 cut(s) 115
PcsI WCGNNNNNNNCGW 2 cut(s) 42, 120
PfeI GAWTC 2 cut(s) 71, 98
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 2 cut(s) 139, 178
RsaNI GTAC 2 cut(s) 138, 177
SaqAI TTAA 1 cut(s) 223
Sau3AI GATC 1 cut(s) 115
Sau96I GGNCC 1 cut(s) 4
SetI ASST 1 cut(s) 187
SgeI CNNG 7 cut(s) 24, 47, 65, 134, 169, 182, 192
SinI GGWCC 1 cut(s) 4
Sse9I AATT 3 cut(s) 75, 125, 204
TaaI ACNGT 1 cut(s) 221
TasI AATT 3 cut(s) 75, 125, 204
TatI WGTACW 1 cut(s) 137
TfiI GAWTC 2 cut(s) 71, 98
Tru1I TTAA 1 cut(s) 223
Tru9I TTAA 1 cut(s) 223
TscAI CASTG 1 cut(s) 63
TspDTI ATGAA 3 cut(s) 77, 81, 90
TspGWI ACGGA 1 cut(s) 34
TspRI CASTG 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 2 cut(s) 125, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.