AT5G39645

Defensin-like protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
15873392 .. 15873680
289 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G39645.1

Sequence Viewer

Length: 186 bp
ATGGTTAAAACAAATGTTGTCTCTTTTGTTTTATTTGCTGCTATTGTGCTATGTATAGGATCCATTCAAATAAATGGACAAAAACACATTGCACCGTGGATATCTGAAGAAAAATCGATATGTTGTAGAGAACATCCGAGTCTTGGAAGGTGTCTTCCAGGCATTGATGATAGGCCACGAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.76

Weight (kDa)

8.49

Isoelectric Point (pI)

28.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 54, 67
AcuI CTGAAG 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 1 cut(s) 68
AjnI CCWGG 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 25
AlwI GGATC 2 cut(s) 54, 67
AoxI GGCC 1 cut(s) 173
ApeKI GCWGC 1 cut(s) 38
BamHI GGATCC 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 146
BbvI GCAGC 1 cut(s) 25
BciT130I CCWGG 1 cut(s) 159
BcoDI GTCTC 1 cut(s) 25
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 159
BpiI GAAGAC 1 cut(s) 146
Bsa29I ATCGAT 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse3DI GCAATG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 159
BseCI ATCGAT 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMI GCAATG 1 cut(s) 87
BseXI GCAGC 1 cut(s) 25
BshFI GGCC 1 cut(s) 175
BshVI ATCGAT 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 143
BsmAI GTCTC 1 cut(s) 25
BsnI GGCC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 59
BspANI GGCC 1 cut(s) 175
BspDI ATCGAT 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 61
BspPI GGATC 2 cut(s) 54, 67
BsrDI GCAATG 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 1 cut(s) 59
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 96
BstDSI CCRYGG 1 cut(s) 95
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 1 cut(s) 62
BstMAI GTCTC 1 cut(s) 25
BstMBI GATC 1 cut(s) 59
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstV1I GCAGC 1 cut(s) 25
BstV2I GAAGAC 1 cut(s) 146
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
Bsu15I ATCGAT 1 cut(s) 116
BsuRI GGCC 1 cut(s) 175
BsuTUI ATCGAT 1 cut(s) 116
BtgI CCRYGG 1 cut(s) 95
BtsCI GGATG 1 cut(s) 133
ClaI ATCGAT 1 cut(s) 116
CviJI RGCY 1 cut(s) 175
CviKI_1 RGCY 1 cut(s) 175
DpnI GATC 1 cut(s) 61
DpnII GATC 1 cut(s) 59
Eco32I GATATC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 126
EcoRII CCWGG 1 cut(s) 157
EcoRV GATATC 1 cut(s) 102
FaiI YATR 3 cut(s) 52, 56, 121
Fnu4HI GCNGC 1 cut(s) 39
FokI GGATG 1 cut(s) 120
Fsp4HI GCNGC 1 cut(s) 39
GluI GCNGC 1 cut(s) 39
HaeIII GGCC 1 cut(s) 175
HinfI GANTC 2 cut(s) 139, 180
Hpy188I TCNGA 3 cut(s) 106, 138, 185
HpyAV CCTTC 1 cut(s) 141
HpyCH4III ACNGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 92
Kzo9I GATC 1 cut(s) 59
LpnPI CCDG 2 cut(s) 144, 171
Lsp1109I GCAGC 1 cut(s) 25
MalI GATC 1 cut(s) 61
MboI GATC 1 cut(s) 59
MboII GAAGA 2 cut(s) 119, 146
MflI RGATCY 1 cut(s) 59
MlyI GAGTC 1 cut(s) 148
MseI TTAA 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NdeII GATC 1 cut(s) 59
NlaIV GGNNCC 1 cut(s) 61
PfeI GAWTC 1 cut(s) 180
PkrI GCNGC 1 cut(s) 40
PleI GAGTC 1 cut(s) 147
PpsI GAGTC 1 cut(s) 147
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 59
SaqAI TTAA 1 cut(s) 6
SatI GCNGC 1 cut(s) 39
Sau3AI GATC 1 cut(s) 59
SchI GAGTC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 159
SetI ASST 1 cut(s) 152
SgeI CNNG 5 cut(s) 108, 150, 155, 170, 171
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 96
TaqI TCGA 1 cut(s) 116
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TseI GCWGC 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.