Prupe.6G209800_v2.0.a1

Cysteine-rich antifungal protein 2, defensin-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
21810868 .. 21811571
704 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G209800.1

Sequence Viewer

Length: 249 bp
ATGGCTAAGTTTACAATCCCTTGTTTCGTCCTCATTTTGGTGCTCTTGTCAACCACCAATGTTTGGAAGATAGCAACTGTTGAAGGTTCCAAGTGTTGTACTGATCATCCTGAACTTGGAAAGTGTGTCCCTGGTGCGGATGACAACCCAAATAGTGGAAAATGCTGGAAATTTTGCACTTCAGGTTGTGAGAAAGGAGGCATCTGCAAACTATTTGGCGACCATCATCATTGCCATTGCTTATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

8.9

Weight (kDa)

7.52

Isoelectric Point (pI)

23.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 63, 155
AciI CCGC 1 cut(s) 137
AcsI RAATTY 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 165
AfaI GTAC 1 cut(s) 100
AfiI CCNNNNNNNGG 5 cut(s) 37, 63, 116, 136, 155
AgsI TTSAA 1 cut(s) 83
AjnI CCWGG 1 cut(s) 130
Alw21I GWGCWC 1 cut(s) 45
ApoI RAATTY 1 cut(s) 170
Bbv12I GWGCWC 1 cut(s) 45
BccI CCATC 1 cut(s) 231
BciT130I CCWGG 1 cut(s) 132
BclI TGATCA 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 132
BmiI GGNNCC 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 132
BmsI GCATC 1 cut(s) 210
BsaJI CCNNGG 1 cut(s) 130
Bsc4I CCNNNNNNNGG 5 cut(s) 37, 63, 116, 136, 155
Bse3DI GCAATG 2 cut(s) 229, 235
BseBI CCWGG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 130
BseGI GGATG 2 cut(s) 106, 145
BseLI CCNNNNNNNGG 5 cut(s) 37, 63, 116, 136, 155
BseMI GCAATG 2 cut(s) 229, 235
BsiHKAI GWGCWC 1 cut(s) 45
BslFI GGGAC 1 cut(s) 113
BslI CCNNNNNNNGG 5 cut(s) 37, 63, 116, 136, 155
BsmFI GGGAC 1 cut(s) 113
Bsp1286I GDGCHC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 103
BspACI CCGC 1 cut(s) 137
BspLI GGNNCC 1 cut(s) 88
BsrDI GCAATG 2 cut(s) 229, 235
BssECI CCNNGG 1 cut(s) 130
BssMI GATC 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 132
Bst4CI ACNGT 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 106, 145
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BtsCI GGATG 2 cut(s) 106, 145
Csp6I GTAC 1 cut(s) 99
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 1 cut(s) 99
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eco57I CTGAAG 1 cut(s) 165
EcoRII CCWGG 1 cut(s) 130
FaiI YATR 1 cut(s) 244
FaqI GGGAC 1 cut(s) 113
FbaI TGATCA 1 cut(s) 103
FokI GGATG 2 cut(s) 93, 152
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
Hpy166II GTNNAC 2 cut(s) 12, 51
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 2 cut(s) 12, 51
HpyAV CCTTC 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 2 cut(s) 177, 207
HpyF3I CTNAG 1 cut(s) 6
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 1 cut(s) 103
LpnPI CCDG 5 cut(s) 117, 123, 144, 151, 168
LweI GCATC 1 cut(s) 210
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 79
MhlI GDGCHC 1 cut(s) 45
MluCI AATT 1 cut(s) 170
MnlI CCTC 2 cut(s) 41, 191
MslI CAYNNNNRTG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
NdeII GATC 1 cut(s) 103
NlaIV GGNNCC 1 cut(s) 88
PflMI CCANNNNNTGG 2 cut(s) 63, 155
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 88
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
RseI CAYNNNNRTG 1 cut(s) 38
Sau3AI GATC 1 cut(s) 103
ScrFI CCNGG 1 cut(s) 132
SduI GDGCHC 1 cut(s) 45
SetI ASST 2 cut(s) 88, 187
SfaNI GCATC 1 cut(s) 210
SgeI CNNG 9 cut(s) 33, 58, 103, 122, 128, 143, 144, 178, 195
SmiMI CAYNNNNRTG 1 cut(s) 38
Sse9I AATT 1 cut(s) 170
SsiI CCGC 1 cut(s) 137
StyD4I CCNGG 1 cut(s) 130
TaaI ACNGT 1 cut(s) 79
TasI AATT 1 cut(s) 170
TatI WGTACW 1 cut(s) 98
Van91I CCANNNNNTGG 2 cut(s) 63, 155
XapI RAATTY 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.