AT5G08055

Cysteine-rich antifungal protein 2, defensin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0009981
Physical Location & Seq
Forward (+)
2579401 .. 2579802
402 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G08055.1

Sequence Viewer

Length: 246 bp
ATGGCCAGTTTGAAAGTTTTTTCTTTTGCTTTGATCCTTGTTCTCACTTTCTCAGTTGATGTTGAAGGATATAATGTAGAGAGTGGTGGTTCCTTGTGTTGTAATAACCACCCGAAATTTGGAAAGTGCAACACAAACAATGACAATCAGAGATGTAACCGTTGGTGTCACAATGGATGCGGGAATGGAAAAGGCGATTACTGCAAAGCTATGTCTCACGGAGGACTATGTCATTGTTATTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

81

Amino Acids

8.84

Weight (kDa)

8.06

Isoelectric Point (pI)

25.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 32 - 81 2.9e-16 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 180
AclWI GGATC 1 cut(s) 28
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 13, 65
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
Alw26I GTCTC 1 cut(s) 219
AlwI GGATC 1 cut(s) 28
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 116
BalI TGGCCA 1 cut(s) 5
BcoDI GTCTC 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 91
BmsI GCATC 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 6
BseGI GGATG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 6
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 219
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 33
BspACI CCGC 1 cut(s) 180
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 65
BspLI GGNNCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 28
BsrI ACTGG 1 cut(s) 6
BssMI GATC 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 161
BstDEI CTNAG 1 cut(s) 52
BstF5I GGATG 1 cut(s) 182
BstKTI GATC 1 cut(s) 36
BstMAI GTCTC 1 cut(s) 219
BstMBI GATC 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 201
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 182
CviJI RGCY 2 cut(s) 5, 209
CviKI_1 RGCY 2 cut(s) 5, 209
DdeI CTNAG 1 cut(s) 52
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
EaeI YGGCCR 1 cut(s) 3
FaiI YATR 3 cut(s) 72, 212, 229
FauI CCCGC 1 cut(s) 173
FokI GGATG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 5
Hpy188I TCNGA 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4V TGCA 2 cut(s) 129, 204
HpyF10VI GCNNNNNNNGC 1 cut(s) 201
HpyF3I CTNAG 1 cut(s) 52
Kzo9I GATC 1 cut(s) 33
LpnPI CCDG 1 cut(s) 19
LweI GCATC 1 cut(s) 167
MaeIII GTNAC 2 cut(s) 155, 167
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 116
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 215
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 244
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 201
NdeII GATC 1 cut(s) 33
NlaIV GGNNCC 1 cut(s) 91
NmuCI GTSAC 1 cut(s) 167
PflFI GACNNNGTC 1 cut(s) 228
PspN4I GGNNCC 1 cut(s) 91
PsyI GACNNNGTC 1 cut(s) 228
SaqAI TTAA 1 cut(s) 244
Sau3AI GATC 1 cut(s) 33
SetI ASST 1 cut(s) 211
SfaNI GCATC 1 cut(s) 167
SgeI CNNG 6 cut(s) 18, 50, 106, 124, 193, 230
Sse9I AATT 1 cut(s) 116
SsiI CCGC 1 cut(s) 180
TaaI ACNGT 1 cut(s) 161
TasI AATT 1 cut(s) 116
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspGWI ACGGA 1 cut(s) 234
Tth111I GACNNNGTC 1 cut(s) 228
XapI RAATTY 1 cut(s) 116
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.