Rh2AG216900

Defensin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0009981
Physical Location & Seq
Reverse (-)
22129784 .. 22133126
3343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG216900.1

Sequence Viewer

Length: 429 bp
ATGGCCAAGATGACTAGGTTTACAATTGCATCCTTTTTTCTTATGCTGATGCTCTTGCTGAGCACAGCAAGTGCTCAAGGTTCAAGGTGTTGCGCCAATCATCCCAAGCTTGGAAGTTGTGTGCCTGACACAGATGACAACCCAGAGAAAAATGGAAAGTGCTGGGTGTATTGCATTGAAGAGTGTAAAGGAGGAATCTGCAAAAACAATGAATATGGAGACAAAGGCAACAATCGCCTGTTGGATGCTTTTGTTGTCAAATCAAGATCTACAATTTCAACTTCTTTGGAATCCTCTGTGTTTTTCGATTCAACATTAGTCACTTCAGGTCGAAGTATGTCAAGATTGATGAAACAAATGTCATCCTTTGAGATCTCTGCAACACTTTTGGGTTCAGTAACTGGTCAAATCCTATATTCCCCATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

142

Amino Acids

15.49

Weight (kDa)

8.5

Isoelectric Point (pI)

48.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 29 - 72 6.9e-08 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 309
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 4 cut(s) 84, 179, 279, 312
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Alw21I GWGCWC 2 cut(s) 65, 76
Alw26I GTCTC 1 cut(s) 213
AlwNI CAGNNNCTG 1 cut(s) 401
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 95
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 2 cut(s) 65, 76
BcoDI GTCTC 1 cut(s) 213
BfaI CTAG 1 cut(s) 15
BglII AGATCT 2 cut(s) 266, 372
BlpI GCTNAGC 1 cut(s) 59
BmsI GCATC 3 cut(s) 38, 39, 235
Bpu1102I GCTNAGC 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 406
BseGI GGATG 4 cut(s) 29, 100, 250, 362
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 406
BseYI CCCAGC 1 cut(s) 162
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 2 cut(s) 65, 76
BslI CCNNNNNNNGG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 213
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 2 cut(s) 65, 76
Bsp143I GATC 2 cut(s) 266, 372
Bsp1720I GCTNAGC 1 cut(s) 59
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 51
BsrI ACTGG 1 cut(s) 406
BssMI GATC 2 cut(s) 266, 372
Bst6I CTCTTC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 59
BstF5I GGATG 4 cut(s) 29, 100, 250, 362
BstHHI GCGC 1 cut(s) 95
BstKTI GATC 2 cut(s) 269, 375
BstMAI GTCTC 1 cut(s) 213
BstMBI GATC 2 cut(s) 266, 372
BstMWI GCNNNNNNNGC 1 cut(s) 234
BstX2I RGATCY 2 cut(s) 266, 372
BstYI RGATCY 2 cut(s) 266, 372
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 4 cut(s) 29, 100, 250, 362
CaiI CAGNNNCTG 1 cut(s) 401
CfoI GCGC 1 cut(s) 95
CviJI RGCY 2 cut(s) 5, 109
CviKI_1 RGCY 2 cut(s) 5, 109
DdeI CTNAG 1 cut(s) 59
DpnI GATC 2 cut(s) 268, 374
DpnII GATC 2 cut(s) 266, 372
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
Eco57I CTGAAG 1 cut(s) 309
FaiI YATR 4 cut(s) 44, 216, 338, 415
FokI GGATG 4 cut(s) 16, 87, 257, 349
FspBI CTAG 1 cut(s) 15
GlaI GCGC 1 cut(s) 94
GsaI CCCAGC 1 cut(s) 166
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 95
Hin6I GCGC 1 cut(s) 93
HinP1I GCGC 1 cut(s) 93
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 3 cut(s) 195, 290, 308
Hpy166II GTNNAC 1 cut(s) 21
Hpy188III TCNNGA 3 cut(s) 264, 342, 426
Hpy8I GTNNAC 1 cut(s) 21
HpyCH4V TGCA 4 cut(s) 29, 174, 201, 380
HpyF10VI GCNNNNNNNGC 1 cut(s) 234
HpyF3I CTNAG 1 cut(s) 59
HspAI GCGC 1 cut(s) 93
Kzo9I GATC 2 cut(s) 266, 372
LpnPI CCDG 6 cut(s) 138, 148, 156, 251, 312, 387
LweI GCATC 3 cut(s) 38, 39, 235
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 319, 397
MalI GATC 2 cut(s) 268, 374
MboI GATC 2 cut(s) 266, 372
MboII GAAGA 1 cut(s) 191
MfeI CAATTG 1 cut(s) 24
MflI RGATCY 2 cut(s) 266, 372
MhlI GDGCHC 2 cut(s) 65, 76
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 24, 273
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 222
MnlI CCTC 2 cut(s) 185, 304
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MunI CAATTG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 234
NdeII GATC 2 cut(s) 266, 372
NmuCI GTSAC 1 cut(s) 319
PfeI GAWTC 3 cut(s) 195, 290, 308
PspFI CCCAGC 1 cut(s) 162
PstNI CAGNNNCTG 1 cut(s) 401
PsuI RGATCY 2 cut(s) 266, 372
Sau3AI GATC 2 cut(s) 266, 372
SduI GDGCHC 2 cut(s) 65, 76
SetI ASST 5 cut(s) 20, 82, 89, 111, 331
SfaNI GCATC 3 cut(s) 38, 39, 235
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 2 cut(s) 24, 273
SspMI CTAG 1 cut(s) 15
TaqI TCGA 2 cut(s) 306, 331
TasI AATT 2 cut(s) 24, 273
TfiI GAWTC 3 cut(s) 195, 290, 308
TseFI GTSAC 1 cut(s) 319
Tsp45I GTSAC 1 cut(s) 319
TspDTI ATGAA 2 cut(s) 225, 365
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.